SGN Marker C2_At1g64640

SGN-M6949
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle301175 (SGN)
122814 (CGN)
---
Lycopersicon CombinedSingleSGN-U226803---
Solanum tuberosumSingleSGN-U256848---
ArabidopsisSingleAt1g64640 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 25362)
Chromosome
1
Position
24.03 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41136
Forward primer (5'-3')
ATTTAAATGCTTGGAATATACCCTCTTC
Accessions and product sizes
Solanum pennellii TA56
650
Solanum lycopersicum TA209
650
Approximate temperature
58°C
Reverse primer (5'-3')
ATGTACAAGATTGGATTTTTAAGGTTGC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
525
Solanum lycopersicum TA209
650
Mg+2 concentration
1.5mM
   Enzymes
  
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At1g64640  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6949 marker 6949
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)