SGN Marker C2_At1g67325

SGN-M6977
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeMultiple300288 (SGN)
120718 (CGN)
---
Capsicum annuumSingleSGN-U198366---
Lycopersicon CombinedSingleSGN-U216136---
Solanum tuberosumMultipleSGN-U246069---
ArabidopsisSingleAt1g67325 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49219)
Chromosome
5
Position
10.76 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47150)
Chromosome
5
Position
81.30 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46604)
Chromosome
12
Position
26.70 cM
Confidence
I(LOD2)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Pepper-COSII   
Map version
58 (location: 41344)
Chromosome
11
Position
56.40 cM
Confidence
I
Protocol
PCR


Pepper-COSII

PCR data   Exp. ID 43320
Forward primer (5'-3')
TGGCCGTAGGGAAGATGACTGGAC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TACGGGCTCCCCCCAGAAAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38241)
Chromosome
5
Position
68.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39512
Forward primer (5'-3')
TGGCCGTAGGGAAGATGACTGGAC
Accessions and product sizes
Solanum pennellii TA56
150
Solanum lycopersicum TA209
150
Approximate temperature
55°C
Reverse primer (5'-3')
TACGGGCTCCCCCCAGAAAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25390)
Chromosome
1
Position
25.21 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10362
Forward primer (5'-3')
TGGCCGTAGGGAAGATGACTGGAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TACGGGCTCCCCCCAGAAAG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1650
Approximate temperature
55°C
  
PCR data   Exp. ID 10363
Forward primer (5'-3')
TGGCCGTAGGGAAGATGACTGGAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TACGGGCTCCCCCCAGAAAG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1850
Approximate temperature
55°C
  
PCR data   Exp. ID 10364
Forward primer (5'-3')
TGGCCGTAGGGAAGATGACTGGAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TACGGGCTCCCCCCAGAAAG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1850
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Genomic location of C2_At1g67325  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6977 marker 6977
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)