SGN Marker C2_At1g68100

SGN-M6993
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle309910 (SGN)
126940 (CGN)
---
Lycopersicon CombinedMultipleSGN-U217827---
Solanum tuberosumSingleSGN-U253755---
ArabidopsisSingleAt1g68100 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46608)
Chromosome
4
Position
31.00 cM
Confidence
F(LOD3)
Protocol
dCAPS


Tobacco N. tomentosiformis

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38246)
Chromosome
4
Position
13.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39517
Forward primer (5'-3')
TTGACTGGAGAGGAACAGGCTAAATC
Accessions and product sizes
Solanum pennellii TA56
350
Solanum lycopersicum TA209
350
Approximate temperature
55°C
Reverse primer (5'-3')
AAGCCATCCCATCAGTAAAATTGTG
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
350
Solanum lycopersicum TA209
300
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25406)
Chromosome
1
Position
25.53 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10386
Forward primer (5'-3')
TTGACTGGAGAGGAACAGGCTAAATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGCCATCCCATCAGTAAAATTGTG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 10387
Forward primer (5'-3')
TTGACTGGAGAGGAACAGGCTAAATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGCCATCCCATCAGTAAAATTGTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 10388
Forward primer (5'-3')
TTGACTGGAGAGGAACAGGCTAAATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGCCATCCCATCAGTAAAATTGTG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 32224
Forward primer (5'-3')
TTGACTGGAGAGGAACAGGCTAAATC
Digested band sizes (using RsaI)
Solanum lycopersicum LA925: 170
Solanum pennellii LA716: 200
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGCCATCCCATCAGTAAAATTGTG
Enzymes
All possible enzymes for pennellii and and lycopersicum: RsaI
  
Accessions and product sizes
Solanum lycopersicum LA925: 200
Solanum pennellii LA716: 200
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At1g68100F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, PDF chromatogram
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, PDF chromatogram
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, PDF chromatogram
Forward amplicon sequence for S. pennellii TA56, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text

Genomic location of C2_At1g68100  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6993 marker 6993
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)