SGN Marker TG589

SGN-M7

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
700
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG589 image not available
Forward sequence
ATAATGCTGGTTTACGAGTTTATGCCTAATGGTACTCTGAGAGACCACCTATCTGGTAAATAATTATATAATTCACATTGCTCTTGCCTC
CATTTATTTGTGCAAATCTTTTCCTTCTAGCACTTTATTTTGATAAGGAAAATATTTAAGTATGCAAACGATTAACTAATCCACAACATC
TAGCTTTGTCCCCAACGAAATCCCTTCCGATGAAAATTGTCGAATATCAGTCTTTCTGCTGGTTAATGTTAGGGGATTGGTTTTGGGGGA
AAGCACTAGCAGAAATCAAGTCTTTGACCATATTATATGGGATTTAATGGGTTGACTTGTGGTGTGACAGGTAAATGTAAAGAACCTCTA
AGTTTTGCTATGCGATTGAAAGTTGCCTTAGGTTCCGCTAAGGGCATTCTATACTTGCACACGGAGGCTGATCCTCCCATATTCCATCGA
GATATCAAGGCAAGCAATATATTGCTAGACTCTAAGTTTATTGCAAAGGTGGCTGACTTTGGACTTTCACGGCTTGCTCCAGTTCCAGAT
CTTGAAGGGACTCTGCCTGCTCATGTATCGACAGTTGTTAAGGGCACTCCGGTGAGCATTGATTGTTCAAGGAAGTGGATATTT
Reverse sequence
AGAACGAGCATTAGAGCCACAAGGTAGGATCACAAATATTTAGGTCAAAATATCCACTTCCTTGAACAATCAATGCTCACCGGAGTGCCC
TTAACAACTGTCGATACATGAGCAGGCAGAGTCCCTTCAAGATCTGGAACTGGAGCAAGCCGTGAAAGTCCAAAGTCAGCCACCTTTGCA
ATAAACTTAGAGTCTAGCAATATATTGCTTGCCTTGATATCTCGATGGAATATGGGAGGATCAGCCTCCGTGTGCAAGTATAGAATGCCC
TTAGCGGAACCTAAGGCAACTTTCAATCGCATAGCAAAACTTAGAGGTTCTTTACATTTACCTGTCACACCACAAGTCAACCCATTAAAT
CCCATATAATATGGTCAAAGACTTGATTTCTGCTAGTGCTTTCCCCCAAAACCAATCCCCTAACATTAACCAGCAGAAAGACTGATATTC
GACAATTTTCATCGGAAGGGATTTCGTTGGGGACAAAGCTAGATGTTGTGGATTAGTTAATCGTTTGCATACTTAAATATTTTCCTTATC
AAAATAAAGTGCTAGAAGGAAAAGATTTGCACAAATAAATGGAGGCAAGAGCAATGTGAATTATA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1732172.3e-2558 (9.3% of RFLP seq)+
SGN-U1732172.3e-62120 (19.2% of RFLP seq)+
SGN-U1732172.2e-62120 (19.8% of RFLP seq)-
Mapped locations  
Map: Eggplant-COSII   
Map version
63 (location: 42491)
Chromosome
9
Position
49.60 cM
Confidence
I
Protocol
RFLP


Eggplant-COSII

Map: Eggplant-LXM 2002   
Map version
29 (location: 7711)
Chromosome
9
Position
54.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 7710)
Chromosome
9
Position
54.40 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG589 was used as an overgo probe on plate 16 [well B3]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CTTAGGTTCCGCTAAGGGCATTCT
B sequence
CTCCGTGTGCAAGTATAGAATGCC
AB sequence
CTTAGGTTCCGCTAAGGGCATTCTATACTT
Marker sequence
ATAATGCTGGTTTACGAGTTTATGCCTAATGGTACTCTGAGAGACCACCT
ATCTGGTAAATAATTATATAATTCACATTGCTCTTGCCTCCATTTATTTG
TGCAAATCTTTTCCTTCTAGCACTTTATTTTGATAAGGAAAATATTTAAG
TATGCAAACGATTAACTAATCCACAACATCTAGCTTTGTCCCCAACGAAA
TCCCTTCCGATGAAAATTGTCGAATATCAGTCTTTCTGCTGGTTAATGTT
AGGGGATTGGTTTTGGGGGAAAGCACTAGCAGAAATCAAGTCTTTGACCA
TATTATATGGGATTTAATGGGTTGACTTGTGGTGTGACAGGTAAATGTAA
AGAACCTCTAAGTTTTGCTATGCGATTGAAAGTTGCCTTAGGTTCCGCTA
AGGGCATTCTATACTTGCACACGGAGGCTGATCCTCCCATATTCCATCGA
GATATCAAGGCAAGCAATATATTGCTAGACTCTAAGTTTATTGCAAAGGT
GGCTGACTTTGGACTTTCACGGCTTGCTCCAGTTCCAGATCTTGAAGGGA
CTCTGCCTGCTCATGTATCGACAGTTGTTAAGGGCACTCCGGTGAGCATT
GATTGTTCAAGGAAGTGGATATTT
Genomic location of TG589  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7 marker 7
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)