SGN Marker TG360

SGN-M70

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1500
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
AAACCAGATTCTAGTAATAAAATTTTAACTAGAAAAGAAAAGCAGGATGCGGCAAAATGATCTGGGTCCTTTCAATTAATATCAAATCTC
CACATGTCTATTTTAAGGCTGGGACCCGGACATTTAATGGATAAGCCGATAAGGGGTATATTTGGTTCAAAGCATAGCAGTAAGGATATG
TATAATAGTGAAACGGAGGATGAGTATGAAAAATATTTGAAAGTAAAGGGGCAAATATGACCCTTTTCTGCAATTAAAATTGTAAAATAC
ACCATCTTGAAGAAGTTATGTTGCAACTCTTGCTTTAATTATGCTTGAAAGTAGATAGCTATGTGCTGACAATATACGACAGTACCTTAA
CATATTGATGAAATCTGATAAGATAGCCCCAGAACACCTCTCCATATCCTCAATAATTACAACCACTGGTTTCTCATACTTGCCATGGTC
ACTATACCATGATGCTAAGAGCGAAACATC
Reverse sequence
TAACTCCTGGGAAGATCCACTAAAAGAAGACTTGACTCTTCATCAAAAGTATCATTAAGCAATGAGAACTTGAAAATGGAAGCTTTCCGA
TGTGTATGGTCAAAAATCGAATCCAAGATTAAGGTTCTTCTTTCCCGATTTTGTTCCTGAAATGTTATAGATATTTTCGTTGATCCAATT
CAGTGTAAATTAAGTGATGCTAAATTGCTTATTTCTTGATGTTTGAGAATTGAATTTAGGATGTCTTGAGGAGTATAAATGCCGGCGTGT
TTGATGAGATAGGACAATGGGTTCGTGAATCTTTTAATGAAATTTGTTCGTGCAGAGGGCCTGTTGATCCATCAAAGTCAAGTCTTCCAT
ACCCTTTTGTCCATAATGGTGGTTTAGTTAAAAAGCTCTTCACTGGTCTGGTCTTCACCAGTAAGTTCATTTTTCATTTATTTTAGACGT
TTAGTTTGCAAATATGAAACTATGCTGATGGTAACCAAT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1636891.4e-0744 (9.0% of RFLP seq)-
SGN-U1636884e-54106 (21.7% of RFLP seq)-
SGN-U1636882.6e-55124 (25.4% of RFLP seq)-
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53283)
Chromosome
12
Position
36.62 cM
Confidence
uncalculated
Protocol
unknown

MQTL_2_Late_blight_12 MQTL_1_Late_blight_12
Potato meta-QTL consensus map

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50377)
Chromosome
12
Position
4.68 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48311)
Chromosome
12
Position
50.67 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Sun1642 x LA1589   
Map version
85 (location: 43862)
Chromosome
12
Position
29.10 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43605)
Chromosome
12
Position
44.60 cM
Confidence
uncalculated
Protocol
RFLP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43324)
Chromosome
12
Position
38.40 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40865)
Chromosome
12
Position
32.00 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40013)
Chromosome
12
Position
50.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 7947)
Chromosome
12
Position
40.20 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 7946)
Chromosome
12
Position
0.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 7951)
Chromosome
12
Position
48.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG360 was used as an overgo probe on plate 4 [well B11]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
AGAAAAGCAGGATGCGGCAAAATG
B sequence
TTGAAAGGACCCAGATCATTTTGC
AB sequence
AGAAAAGCAGGATGCGGCAAAATGATCTGG
Marker sequence
AAACCAGATTCTAGTAATAAAATTTTAACTAGAAAAGAAAAGCAGGATGC
GGCAAAATGATCTGGGTCCTTTCAATTAATATCAAATCTCCACATGTCTA
TTTTAAGGCTGGGACCCGGACATTTAATGGATAAGCCGATAAGGGGTATA
TTTGGTTCAAAGCATAGCAGTAAGGATATGTATAATAGTGAAACGGAGGA
TGAGTATGAAAAATATTTGAAAGTAAAGGGGCAAATATGACCCTTTTCTG
CAATTAAAATTGTAAAATACACCATCTTGAAGAAGTTATGTTGCAACTCT
TGCTTTAATTATGCTTGAAAGTAGATAGCTATGTGCTGACAATATACGAC
AGTACCTTAACATATTGATGAAATCTGATAAGATAGCCCCAGAACACCTC
TCCATATCCTCAATAATTACAACCACTGGTTTCTCATACTTGCCATGGTC
ACTATACCATGATGCTAAGAGCGAAACATC
Genomic location of TG360  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D70 marker 70
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)