SGN Marker C2_At1g69420

SGN-M7005
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle302941 (SGN)
121730 (CGN)
---
Lycopersicon CombinedSingleSGN-U221736---
ArabidopsisSingleAt1g69420 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49222)
Chromosome
5
Position
5.96 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47153)
Chromosome
5
Position
74.50 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Eggplant-COSII   
Map version
63 (location: 42193)
Chromosome
10
Position
69.80 cM
Confidence
F(LOD3)
Protocol
CAPS


Eggplant-COSII

PCR data   Exp. ID 43757
Forward primer (5'-3')
TCATTGCTCTCAGAGATCAAGAGCAAC
Accessions and product sizes
Approximate temperature
50°C
Reverse primer (5'-3')
TGGTTTCAAAGGGTAACTCTGCAGG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-COSII   
Map version
58 (location: 41348)
Chromosome
11
Position
29.30 cM
Confidence
I(LOD2)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43324
Forward primer (5'-3')
TCATTGCTCTCAGAGATCAAGAGCAAC
Accessions and product sizes
Approximate temperature
53°C
Reverse primer (5'-3')
TGGTTTCAAAGGGTAACTCTGCAGG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38249)
Chromosome
5
Position
62.70 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39520
Forward primer (5'-3')
TCATTGCTCTCAGAGATCAAGAGCAAC
Accessions and product sizes
Solanum pennellii TA56
700+1350
Solanum lycopersicum TA209
1350
Approximate temperature
55°C
Reverse primer (5'-3')
TGGTTTCAAAGGGTAACTCTGCAGG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25418)
Chromosome
1
Position
26.10 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10392
Forward primer (5'-3')
TCATTGCTCTCAGAGATCAAGAGCAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGTTTCAAAGGGTAACTCTGCAGG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 10393
Forward primer (5'-3')
TCATTGCTCTCAGAGATCAAGAGCAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGTTTCAAAGGGTAACTCTGCAGG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 10394
Forward primer (5'-3')
TCATTGCTCTCAGAGATCAAGAGCAAC
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
TGGTTTCAAAGGGTAACTCTGCAGG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1250
Approximate temperature
55°C
  
PCR data   Exp. ID 32225
Forward primer (5'-3')
TCATTGCTCTCAGAGATCAAGAGCAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGTTTCAAAGGGTAACTCTGCAGG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1250
Approximate temperature
55°C
  
PCR data   Exp. ID 32226
Forward primer (5'-3')
TCATTGCTCTCAGAGATCAAGAGCAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGTTTCAAAGGGTAACTCTGCAGG
Enzymes
All possible enzymes for pennellii and and lycopersicum: AluI,BanI,BsaBI,BslI,BsoBI,DpnII,MspI,NgoMIV
All possible enzymes for lycopersicum and pimpinellifolium: AluI,ApoI,SsPI
  
Accessions and product sizes
Solanum lycopersicum LA925: 1300
Solanum pennellii LA716: 1300
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At1g69420F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, PDF chromatogram
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, PDF chromatogram
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, PDF chromatogram
Forward amplicon sequence for S. pennellii TA56, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text


Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At1g69420F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, PDF chromatogram
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, PDF chromatogram
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, PDF chromatogram
Forward amplicon sequence for S. pennellii TA56, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text

Genomic location of C2_At1g69420  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7005 marker 7005
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)