Sol Genomics Network

SGN Marker C2_At1g71810

SGN-M7029
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

Synonyms

None

Locus associations

None

Orthologs in this COSII group

Species	Copies	Sequence ID	CDS/Edited sequence	Peptide sequence	Predicted introns
Coffee	Single	301907 (SGN) 124608 (CGN)	-	-	-
Solanum tuberosum	Single	SGN-U267574	-	-	-
Arabidopsis	Single	At1g71810 on TAIR	-	-	-

Mapped locations

Map: Tobacco N. tomentosiformis
Map version 91 (location: 46610)
Chromosome 4
Position 52.70 cM
Confidence F(LOD3)
Protocol CAPS

Tobacco N. tomentosiformis

Map: Tobacco N. acuminata
Map version 89 (location: 46451)
Chromosome 4
Position 37.80 cM
Confidence I(LOD2)
Protocol dCAPS

Tobacco N. acuminata

Map: Pepper-COSII
Map version 58 (location: 41350)
Chromosome 4
Position 90.80 cM
Confidence F(LOD3)
Protocol CAPS

Pepper-COSII

PCR data Exp. ID 43326

Forward primer (5'-3')

TCATGCAGATCCACATCCTGGAAAC

Accessions and product sizes

Approximate temperature

55°C

Reverse primer (5'-3')

AGTGACAAAATCCTTGGCCAATGC

Digested band sizes (using unknown enzyme)

Mg⁺² concentration

Unknown

Enzymes

Map: Tomato-EXPEN 2000
Map version 52 (location: 38252)
Chromosome 4
Position 71.50 cM
Confidence I
Protocol CAPS

Tomato-EXPEN 2000

PCR data Exp. ID 39523

Forward primer (5'-3')

TCATGCAGATCCACATCCTGGAAAC

Accessions and product sizes

Solanum lycopersicum TA209

580

Solanum pennellii TA56

580

Approximate temperature

55°C

Reverse primer (5'-3')

AGTGACAAAATCCTTGGCCAATGC

Digested band sizes (using amplicon difference)

Solanum lycopersicum TA209

300

Solanum pennellii TA56

380

Mg⁺² concentration

1.5mM

Enzymes

Map: Arabidopsis COSII
Map version 44 (location: 25442)
Chromosome 1
Position 27.01 MB
Confidence uncalculated
Protocol CAPS

Arabidopsis COSII

Other PCR data

PCR data Exp. ID 10404
Forward primer (5'-3') TCATGCAGATCCACATCCTGGAAAC		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') AGTGACAAAATCCTTGGCCAATGC	Enzymes
Accessions and product sizes Solanum pennellii LA716: 1050	Approximate temperature 55°C

PCR data Exp. ID 10405
Forward primer (5'-3') TCATGCAGATCCACATCCTGGAAAC		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') AGTGACAAAATCCTTGGCCAATGC	Enzymes
Accessions and product sizes Solanum lycopersicum LA925: 1050	Approximate temperature 55°C

PCR data Exp. ID 10406
Forward primer (5'-3') TCATGCAGATCCACATCCTGGAAAC		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') AGTGACAAAATCCTTGGCCAATGC	Enzymes
Accessions and product sizes Solanum pimpinellifolium LA1589: 1050	Approximate temperature 55°C

PCR data Exp. ID 10407
Forward primer (5'-3') TCATGCAGATCCACATCCTGGAAAC	Digested band sizes (using CfoI) Solanum lycopersicum LA925: 700+350 Solanum pennellii LA716: 1050	Mg⁺² concentration 1.5mM
Reverse primer (5'-3') AGTGACAAAATCCTTGGCCAATGC	Enzymes All possible enzymes for pennellii and and lycopersicum: AvaII,BslI,BstUI,CfoI/HhaI,HinfI,NheI,Sau96I,StyI,TaqI, All possible enzymes for lycopersicum and pimpinellifolium: AvaII,BstUI,CfoI/HhaI,Sau96I,StyI
Accessions and product sizes Solanum lycopersicum LA925: 1050 Solanum pennellii LA716: 1050	Approximate temperature 55°C

Universal primers for Asterid species

No additional PCR data found.

Other COSII sequence data

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Related Markers

Related Genotyped Markers: These markers have been genotyped and share a name with this marker

Genomic location of C2_At1g71810

%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7029 marker 7029

User comments

Please wait, checking for comments. (If comments do not show up, access them here)

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL:

SGN is supported by , and hosted at
Cite SGN using | Disclaimer