SGN Marker C2_At1g71950

SGN-M7032
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle301053 (SGN)
120665 (CGN)
---
Lycopersicon CombinedSingleSGN-U221384---
ArabidopsisSingleAt1g71950 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38253)
Chromosome
6
Position
46.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39524
Forward primer (5'-3')
TGAGCAACCTAAAGATCAAGAACCTG
Accessions and product sizes
Solanum lycopersicum TA209
750
Solanum pennellii TA56
750
Approximate temperature
55°C
Reverse primer (5'-3')
TAACAATGCCTCTTTTGCAGCCTC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
750
Solanum pennellii TA56
350+400
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25445)
Chromosome
1
Position
27.08 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10408
Forward primer (5'-3')
TGAGCAACCTAAAGATCAAGAACCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAACAATGCCTCTTTTGCAGCCTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 10409
Forward primer (5'-3')
TGAGCAACCTAAAGATCAAGAACCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAACAATGCCTCTTTTGCAGCCTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 10410
Forward primer (5'-3')
TGAGCAACCTAAAGATCAAGAACCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAACAATGCCTCTTTTGCAGCCTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 10411
Forward primer (5'-3')
TGAGCAACCTAAAGATCAAGAACCTG
Digested band sizes (using EcoRI)
Solanum pennellii LA716: 250
Solanum lycopersicum LA925: 300
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAACAATGCCTCTTTTGCAGCCTC
Enzymes
All possible enzymes for pennellii and and lycopersicum: AvaII,BstZ17I,EcoRI,Hpy188I
All possible enzymes for lycopersicum and pimpinellifolium: AvaII,BstYI,BstZ17I,EcoO109I,Sau96I
  
Accessions and product sizes
Solanum lycopersicum LA925: 1100
Solanum pennellii LA716: 1100
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At1g71950F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, plain text

Genomic location of C2_At1g71950  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7032 marker 7032
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)