SGN Marker C2_At1g73177

SGN-M7038
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle310001 (SGN)
130841 (CGN)
---
Solanum tuberosumSingleSGN-U257992---
ArabidopsisSingleAt1g73177 on TAIR---
Mapped locations  
Map: Tobacco N. acuminata   
Map version
89 (location: 46452)
Chromosome
11
Position
35.10 cM
Confidence
CF(LOD3)
Protocol
PCR


Tobacco N. acuminata

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38255)
Chromosome
8
Position
0.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39526
Forward primer (5'-3')
AGTCCTCATAGATGTTGTGGATGAAGA
Accessions and product sizes
Solanum pennellii TA56
900
Solanum lycopersicum TA209
900
Approximate temperature
55°C
Reverse primer (5'-3')
TCGTGCCATGTATCTCCATCAACTT
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
500
Solanum pennellii TA56
700
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25451)
Chromosome
1
Position
27.52 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At1g73177  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7038 marker 7038
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)