SGN Marker C2_At1g73840

SGN-M7044
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle304401 (SGN)
121675 (CGN)
---
Capsicum annuumSingleSGN-U205068---
Lycopersicon CombinedMultipleSGN-U215801---
Solanum tuberosumSingleSGN-U246377---
ArabidopsisSingleAt1g73840 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 25457)
Chromosome
1
Position
27.77 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41161
Forward primer (5'-3')
AGATCGAGGATCTCCTTGGATTCC
Accessions and product sizes
Solanum pennellii TA56
900
Solanum lycopersicum TA209
900
Approximate temperature
58°C
Reverse primer (5'-3')
TGAAGAAGTGCCTGCTCCATCTC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
500
Solanum pennellii TA56
350
Mg+2 concentration
1.5mM
   Enzymes
  
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At1g73840  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7044 marker 7044
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)