SGN Marker C2_At1g74730

SGN-M7053
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U205320---
Lycopersicon CombinedSingleSGN-U215779---
ArabidopsisSingleAt1g74730 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46612)
Chromosome
2
Position
59.40 cM
Confidence
F(LOD3)
Protocol
PCR


Tobacco N. tomentosiformis

Map: Tobacco N. acuminata   
Map version
89 (location: 46454)
Chromosome
3
Position
65.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. acuminata

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38261)
Chromosome
3
Position
98.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 41165
Forward primer (5'-3')
AATAATGGCTTTAGTTCCAAGCCC
Accessions and product sizes
Solanum lycopersicum TA209
350
Solanum pennellii TA56
350
Approximate temperature
55°C
Reverse primer (5'-3')
AACCATTGCTTTTTCCAATTGTCATC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
350
Solanum pennellii TA56
300
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25466)
Chromosome
1
Position
28.08 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At1g74730  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7053 marker 7053
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)