SGN Marker SSR34

SGN-M707

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 50 High: 45
Repeat motif: GA   Repeat number: 7
Repeat motif: TCGA   Repeat number: 2
Repeat motif:    Repeat number:
Forward primer: TTCGGATAAAGCAATCCACC
Reverse primer: TCGATTGTGTACCAACGTCC
Predicted size: 184
Mapped locations  
Map: Sun1642 x LA1589   
Map version
85 (location: 43803)
Chromosome
10
Position
17.90 cM
Confidence
uncalculated
Protocol
SSR


Sun1642 x LA1589

PCR data   Exp. ID 44812
Forward primer (5'-3')
TTCGGATAAAGCAATCCACC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TCGATTGTGTACCAACGTCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43263)
Chromosome
10
Position
16.10 cM
Confidence
uncalculated
Protocol
SSR


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

PCR data   Exp. ID 44626
Forward primer (5'-3')
TTCGGATAAAGCAATCCACC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TCGATTGTGTACCAACGTCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-LXCHM 2007   
Map version
68 (location: 42994)
Chromosome
10
Position
16.70 cM
Confidence
uncalculated
Protocol
SSR


Tomato-LXCHM 2007

PCR data   Exp. ID 43994
Forward primer (5'-3')
TTCGGATAAAGCAATCCACC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TCGATTGTGTACCAACGTCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40763)
Chromosome
10
Position
13.00 cM
Confidence
uncalculated
Protocol
SSR


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39229)
Chromosome
10
Position
25.30 cM
Confidence
I(LOD2)
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14143
Forward primer (5'-3')
TTCGGATAAAGCAATCCACC
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TCGATTGTGTACCAACGTCC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 184+191
Solanum lycopersicum LA925: 184+183
Approximate temperature
50°C
  
PCR data   Exp. ID 125
Forward primer (5'-3')
TTCGGATAAAGCAATCCACC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGATTGTGTACCAACGTCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 184+184
Solanum pennellii LA716: 184+186
Approximate temperature
45°C
  
Overgo hybridization and physical mapping 
SSR34 was used as an overgo probe on plate 15 [well E9]

Plausible BAC Matches:   P261J23

 Overgo Sequences

A sequence
GGTCGAAGGACAAAAGTCTCTCGA
B sequence
TCTCTCTCTCTCTCGATCGAGAGA
AB sequence
GGTCGAAGGACAAAAGTCTCTCGATCGAGA
Marker sequence
ATTTGAAAATAAATTTGGAGCTAGAAACCCCGCTCAAACGTTTGCATAAG
ATGAACATAATATAATTTCGGATAAAGCAATCCACCATAGACAAGACGAA
ACTATGTTAAAGGTTCCAAGGTCGAAGGACAAAAGTCTCTCGATCGAGAG
AGAGAGAGAGATTTGGCAATAACGTCTTTCATTGACGATTTCTACTCCAG
AATTTAGGTGTTCGTTCTTGAAAATCAGGGGGACGTTGGTACACAATCGA
TGCAGCTTTAATCAAAATGCCAGCAGTTATAGCCCATATTATATACTTCT
CATTCTCTGTTTCATGATCAAAGAAATGAAGAACATATTCATCTCCCATG
TATTCACG
Genomic location of SSR34  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D707 marker 707
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)