SGN Marker TG508

SGN-M71

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1600
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
CTTCTTATCCAGATCTCGAAGAAAAACTTCCCAGTATCCTGAACAACAAAAGTCGACCAATTGACAATGGAGCCAGCAATGATCCCGGGG
TATATTATGTTCTCAAACTCCTCGTGGTTTAATTCATCTTCATGCATATTTGGTATCTGATTGTATAATATACACTGAGCCTCTGTGGAG
ATGGATATGCTTGAGAGTCCCTGAATCTCTTGTGGAAACTGGCAGTATCTTGCTACATGTTATGAGTCTAATTTCATTTTACTTGCTTAT
TAAGAATGTCTTTTCTAGTTTCTATTCCCGACTTATCATTATTTTTCCCTTTGGATGTGATATTCATGGACTACTTGTTGATCTTAAGTC
ATTACCTACAGTAAGCTTCTTGTTGATCTTAAGTCATTACCTACACTAAGCTTTTTGTTGATCTTAAGTCATTACCTACAGTAAGCTTCT
TGTTGATC
Reverse sequence
TATAAAAATGATCATCGGATTTGCAGCATGTAGAGGGAACAAAGAGAACCACATTGGCAAAATGGCCTCCATAAGGTACTTCTATTAATT
AAGACTACAGTTCTTATCTAATCGAACAATGCACTTTGATTAATTAATACTTGGTTTAACAAAAAGGTCCGTCTTGGGAAAGTGAATTTA
GGATATGGAATTTGGGAAAAGGATGTACTCAGTTTTTCCAGCAGTCTTTCTCAATTTTGGAAAGAAAAATTAAGCTTTTCATCTATTAGA
AGGCTCAGTAGTTTACAGACTACCATATGTTCAACGCAGATATGGAGTAATATAGGTTTCTCCACGGAAGATACAGAGATAAAAAGATAG
ATCTTGAGAAGTAGATAGGGTCCTTACATCTCCATCATACAGATATCCCCAGTGGGCATCGAGAACTTGATTAACTGAGATTTCATCACT
GGATTCCACAGGATAAACA
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53346)
Chromosome
11
Position
21.30 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_11 MQTL_1_Maturity_11 MQTL_2_Late_blight_11 MQTL_2_Maturity_11
Potato meta-QTL consensus map

Map: Sun1642 x LA1589   
Map version
85 (location: 43875)
Chromosome
11
Position
22.10 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43614)
Chromosome
11
Position
17.60 cM
Confidence
uncalculated
Protocol
RFLP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43337)
Chromosome
11
Position
21.80 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Eggplant-COSII   
Map version
63 (location: 42478)
Chromosome
11
Position
24.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40879)
Chromosome
11
Position
20.00 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40069)
Chromosome
11
Position
23.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 7954)
Chromosome
11
Position
26.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 7953)
Chromosome
11
Position
24.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 7952)
Chromosome
11
Position
2.10 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 7956)
Chromosome
11
Position
17.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG508 was used as an overgo probe on plate 10 [well A7]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
ATACACTGAGCCTCTGTGGAGATG
B sequence
GACTCTCAAGCATATCCATCTCCA
AB sequence
ATACACTGAGCCTCTGTGGAGATGGATATG
Marker sequence
CTTCTTATCCAGATCTCGAAGAAAAACTTCCCAGTATCCTGAACAACAAA
AGTCGACCAATTGACAATGGAGCCAGCAATGATCCCGGGGTATATTATGT
TCTCAAACTCCTCGTGGTTTAATTCATCTTCATGCATATTTGGTATCTGA
TTGTATAATATACACTGAGCCTCTGTGGAGATGGATATGCTTGAGAGTCC
CTGAATCTCTTGTGGAAACTGGCAGTATCTTGCTACATGTTATGAGTCTA
ATTTCATTTTACTTGCTTATTAAGAATGTCTTTTCTAGTTTCTATTCCCG
ACTTATCATTATTTTTCCCTTTGGATGTGATATTCATGGACTACTTGTTG
ATCTTAAGTCATTACCTACAGTAAGCTTCTTGTTGATCTTAAGTCATTAC
CTACACTAAGCTTTTTGTTGATCTTAAGTCATTACCTACAGTAAGCTTCT
TGTTGATC
Genomic location of TG508  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D71 marker 71
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)