SGN Marker SSR38

SGN-M711

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 40.909 High: 40
Repeat motif: TCT   Repeat number: 8
Repeat motif:    Repeat number:
Forward primer: GTTTCTATAGCTGAAACTCAACCTG
Reverse primer: GGGTTCATCAAATCTACCATCA
Predicted size: 237
Derivations 
This marker was derived from EST read SGN-E98332
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 52838)
Chromosome
8
Position
92.01 cM
Confidence
uncalculated
Protocol
unknown
Subscript
A

MQTL_1_Late_blight_8 MQTL_1_Maturity_8 MQTL_2_Late_blight_8
Potato meta-QTL consensus map

Map: Sun1642 x LA1589   
Map version
85 (location: 43805)
Chromosome
8
Position
56.60 cM
Confidence
uncalculated
Protocol
SSR


Sun1642 x LA1589

PCR data   Exp. ID 44815
Forward primer (5'-3')
GTTTCTATAGCTGAAACTCAACCTG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
GGGTTCATCAAATCTACCATCA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43265)
Chromosome
8
Position
53.10 cM
Confidence
uncalculated
Protocol
SSR


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

PCR data   Exp. ID 44629
Forward primer (5'-3')
GTTTCTATAGCTGAAACTCAACCTG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
GGGTTCATCAAATCTACCATCA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40765)
Chromosome
8
Position
61.00 cM
Confidence
uncalculated
Protocol
SSR


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39240)
Chromosome
8
Position
55.00 cM
Confidence
F(LOD3)
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 102
Forward primer (5'-3')
GTTTCTATAGCTGAAACTCAACCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
GGGTTCATCAAATCTACCATCA
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 237+237
Solanum pennellii LA716: 215+237
Approximate temperature
50°C
  
Overgo hybridization and physical mapping 
SSR38 was used as an overgo probe on plate 12 [well B11]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
AGCAGAAGATTACCCTTTGAGACC
B sequence
AGCAGCAACAGTTCCAGGTCTCAA
AB sequence
AGCAGAAGATTACCCTTTGAGACCTGGAAC
Marker sequence
TTCAAAATGAACTCACCATCAACAGCAACAAGAAGAAGAAGACCATGTTT
CGTTGAAGAAGATGATGGTCTTGTTTCTATAGCTGAAACTCAACCTGAGT
TCTCAGGCAATAATAATCAAAATCATATTAATAATAATAATAATAACAAT
AACAAGAATCATAATTTGATTTATAGACCTCTTTATTATTCAAGAAGAAA
TAGCATGAAGAATCACTCTTCTTCTTCTTCTTCTTCTTCTTATTCTTTGT
TGTCTCCAAGATCTGTTATTTCTGCTGGAAAATACTGTGATGGTAGATTT
GATGAACCCCATCACTATTTCTTGGATGCTTGTTCTCTTTGTAAGAAAAG
ACTTGGTGATAACAGTGACATCTTCATGTACAGAGGGGACACTCCATTCT
GTAGTGAAGAGTGTAGACAACAAGAAATAGAGAAGGATGAAGCTCAAGAT
AGAAAAAGAAACATTTCTTCTTTAAAAGCTATGAGAAAAAAGGAACAAAA
ACAACAATCAACATCTCCAAACAAAACTTCAGCAGAAGATTACCCTTTGA
GACCTGGAACTGTTGCTGCTGCTTGAGCAAAAAATGATAAATGAATCTAC
TTGGATGAAG
Genomic location of SSR38  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D711 marker 711
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)