SGN Marker C2_At1g80460

SGN-M7129
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle304906 (SGN)
121866 (CGN)
---
Capsicum annuumSingleSGN-U197189---
Lycopersicon CombinedSingleSGN-U216479---
Solanum tuberosumMultipleSGN-U246985---
ArabidopsisSingleAt1g80460 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46622)
Chromosome
3
Position
46.40 cM
Confidence
I(LOD2)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38282)
Chromosome
3
Position
129.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39548
Forward primer (5'-3')
TCTTTATAACGCCATTGTTTGGATG
Accessions and product sizes
Solanum lycopersicum TA209
850
Solanum pennellii TA56
850
Approximate temperature
55°C
Reverse primer (5'-3')
AATCTCAGAATTGCTAATAATCTTTGG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
400+450
Solanum pennellii TA56
850
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25543)
Chromosome
1
Position
30.25 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10488
Forward primer (5'-3')
TCTTTATAACGCCATTGTTTGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATCTCAGAATTGCTAATAATCTTTGG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1100
Approximate temperature
53°C
  
PCR data   Exp. ID 10489
Forward primer (5'-3')
TCTTTATAACGCCATTGTTTGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATCTCAGAATTGCTAATAATCTTTGG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1100
Approximate temperature
53°C
  
PCR data   Exp. ID 10490
Forward primer (5'-3')
TCTTTATAACGCCATTGTTTGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATCTCAGAATTGCTAATAATCTTTGG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1100
Approximate temperature
53°C
  
PCR data   Exp. ID 12236
Forward primer (5'-3')
TCTTTATAACGCCATTGTTTGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAATGGCAATGGAGCCTTC
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 12237
Forward primer (5'-3')
TCTTTATAACGCCATTGTTTGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAATGGCAATGGAGCCTTC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 12238
Forward primer (5'-3')
TCTTTATAACGCCATTGTTTGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAATGGCAATGGAGCCTTC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 12239
Forward primer (5'-3')
TCTTTATAACGCCATTGTTTGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAATGGCAATGGAGCCTTC
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 12880
Forward primer (5'-3')
TCTTTATAACGCCATTGTTTGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATCTCAGAATTGCTAATAATCTTTGG
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 1080
Approximate temperature
55°C
  
PCR data   Exp. ID 12881
Forward primer (5'-3')
TCTTTATAACGCCATTGTTTGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATCTCAGAATTGCTAATAATCTTTGG
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 12882
Forward primer (5'-3')
TCTTTATAACGCCATTGTTTGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATCTCAGAATTGCTAATAATCTTTGG
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 1050
Approximate temperature
55°C
  
PCR data   Exp. ID 12883
Forward primer (5'-3')
TCTTTATAACGCCATTGTTTGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATCTCAGAATTGCTAATAATCTTTGG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 1400
Approximate temperature
55°C
  
PCR data   Exp. ID 12884
Forward primer (5'-3')
TCTTTATAACGCCATTGTTTGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATCTCAGAATTGCTAATAATCTTTGG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 1400
Approximate temperature
55°C
  
PCR data   Exp. ID 12885
Forward primer (5'-3')
TCTTTATAACGCCATTGTTTGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATCTCAGAATTGCTAATAATCTTTGG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1050
Approximate temperature
55°C
  
PCR data   Exp. ID 12886
Forward primer (5'-3')
TCTTTATAACGCCATTGTTTGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATCTCAGAATTGCTAATAATCTTTGG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 12887
Forward primer (5'-3')
TCTTTATAACGCCATTGTTTGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATCTCAGAATTGCTAATAATCTTTGG
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 1080
Approximate temperature
55°C
  
PCR data   Exp. ID 12888
Forward primer (5'-3')
TCTTTATAACGCCATTGTTTGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATCTCAGAATTGCTAATAATCTTTGG
Enzymes
  
Accessions and product sizes
Physalis TA1367: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 12889
Forward primer (5'-3')
TCTTTATAACGCCATTGTTTGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATCTCAGAATTGCTAATAATCTTTGG
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 1050
Approximate temperature
55°C
  
PCR data   Exp. ID 12890
Forward primer (5'-3')
TCTTTATAACGCCATTGTTTGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATCTCAGAATTGCTAATAATCTTTGG
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 1050
Approximate temperature
55°C
  
PCR data   Exp. ID 32615
Forward primer (5'-3')
TCTTTATAACGCCATTGTTTGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATCTCAGAATTGCTAATAATCTTTGG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 32880
Forward primer (5'-3')
TCTTTATAACGCCATTGTTTGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATCTCAGAATTGCTAATAATCTTTGG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 32881
Forward primer (5'-3')
TCTTTATAACGCCATTGTTTGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATCTCAGAATTGCTAATAATCTTTGG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 32882
Forward primer (5'-3')
TCTTTATAACGCCATTGTTTGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATCTCAGAATTGCTAATAATCTTTGG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 1400
Approximate temperature
55°C
  
PCR data   Exp. ID 32883
Forward primer (5'-3')
TCTTTATAACGCCATTGTTTGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATCTCAGAATTGCTAATAATCTTTGG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 1400
Approximate temperature
55°C
  
PCR data   Exp. ID 32884
Forward primer (5'-3')
TCTTTATAACGCCATTGTTTGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATCTCAGAATTGCTAATAATCTTTGG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1050
Approximate temperature
55°C
  
PCR data   Exp. ID 32885
Forward primer (5'-3')
TCTTTATAACGCCATTGTTTGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATCTCAGAATTGCTAATAATCTTTGG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 33331
Forward primer (5'-3')
TCTTTATAACGCCATTGTTTGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAATGGCAATGGAGCCTTC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 10491
Forward primer (5'-3')
TCTTTATAACGCCATTGTTTGGATG
Digested band sizes (using DraI)
Solanum pennellii LA716: 1100
Solanum lycopersicum LA925: 1050
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATCTCAGAATTGCTAATAATCTTTGG
Enzymes
All possible enzymes for pennellii and and lycopersicum: DraI, DpnII
All possible enzymes for lycopersicum and pimpinellifolium: DpnII
  
Accessions and product sizes
Solanum lycopersicum LA925: 1100
Solanum pennellii LA716: 1100
Approximate temperature
53°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text

Genomic location of C2_At1g80460  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7129 marker 7129
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)