SGN Marker SSR40

SGN-M713

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 45 High: 50
Repeat motif: AC   Repeat number: 7
Repeat motif: GC   Repeat number: 7
Repeat motif:    Repeat number:
Forward primer: TGCAGGTATGTCTCACACCA
Reverse primer: TTGCAAGAACACCTCCCTTT
Predicted size: 146
Derivations 
This marker was derived from EST read SGN-E97949
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49370)
Chromosome
2
Position
32.28 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47305)
Chromosome
2
Position
26.45 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39243)
Chromosome
2
Position
22.00 cM
Confidence
F(LOD3)
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 23
Forward primer (5'-3')
TGCAGGTATGTCTCACACCA
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGCAAGAACACCTCCCTTT
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 146+146
Solanum pennellii LA716: 146+180
Approximate temperature
50°C
  
Overgo hybridization and physical mapping 
SSR40 was used as an overgo probe on plate 10 [well G5]

Plausible BAC Matches:   P107I05

 Overgo Sequences

A sequence
ATGCAGGTATGTCTCACACCATGA
B sequence
GCCACACTCAAACTATTCATGGTG
AB sequence
ATGCAGGTATGTCTCACACCATGAATAGTT
Marker sequence
TGGATATGCAGGTATGTCTCACACCATGAATAGTTTGAGTGTGGCATCTG
TATTATTTTGGTAGTGCGCGCGCGCGCGCACACACACACACACATATATG
GATTCATGATGAGGGATAATAGGGAAGAAGATAAAGGGAGGTGTTCTTGC
AAATTTTCTGTAATGGAGCATTTGCTTGTGCTTATAATGTAAATAACATG
TTCCTTTTTTTTTTTCTTCAATAAGTAGCAAATGACATGTCCCTTTTTCT
TCATATCCATATAATTGTCTTGTAGTATGGTAAAATCTCCACAA
Genomic location of SSR40  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D713 marker 713
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)