SGN Marker C2_At2g01770

SGN-M7142
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U202721---
Lycopersicon CombinedSingleSGN-U238734---
Solanum tuberosumSingleSGN-U251609---
ArabidopsisSingleAt2g01770 on TAIR---
Mapped locations  
Map: Eggplant-COSII   
Map version
63 (location: 42197)
Chromosome
11
Position
84.00 cM
Confidence
F(LOD3)
Protocol
dCAPS


Eggplant-COSII

PCR data   Exp. ID 43761
Forward primer (5'-3')
CAGAAGAAATCATGAGTTTGGGAAGC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
ATAAGTGCTGTTTCAAAAGCACTCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-COSII   
Map version
58 (location: 41365)
Chromosome
5
Position
49.80 cM
Confidence
F(LOD3)
Protocol
dCAPS


Pepper-COSII

PCR data   Exp. ID 43341
Forward primer (5'-3')
ACCATGTATGAAAGGAGTTGTACCTCG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AATTTACAGCAACTTGCATATGGAGA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38287)
Chromosome
4
Position
6.50 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39552
Forward primer (5'-3')
AGAACCCACAGGCATGGCTCGAC
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
ATAAGTGCTGTTTCAAAAGCACTCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25557)
Chromosome
2
Position
0.34 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At2g01770  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7142 marker 7142
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)