SGN Marker SSR42

SGN-M715

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 50 High: 50
Repeat motif: CTT   Repeat number: 6
Repeat motif:    Repeat number:
Forward primer: CCATGGCTTCGTTATCCCTA
Reverse primer: TAAAGGTGAAGGAACGGGTG
Predicted size: 182
Derivations 
This marker was derived from EST read SGN-E96837
Mapped locations  
Map: Sun1642 x LA1589   
Map version
85 (location: 43806)
Chromosome
1
Position
106.40 cM
Confidence
uncalculated
Protocol
SSR


Sun1642 x LA1589

PCR data   Exp. ID 44818
Forward primer (5'-3')
CCATGGCTTCGTTATCCCTA
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TAAAGGTGAAGGAACGGGTG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43266)
Chromosome
1
Position
107.30 cM
Confidence
uncalculated
Protocol
SSR


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

PCR data   Exp. ID 44632
Forward primer (5'-3')
CCATGGCTTCGTTATCCCTA
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TAAAGGTGAAGGAACGGGTG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40766)
Chromosome
1
Position
122.00 cM
Confidence
uncalculated
Protocol
SSR


Tomato-EXPIMP 2008
Other PCR data 
PCR data   Exp. ID 31732
Forward primer (5'-3')
CCATGGCTTCGTTATCCCTA
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TAAAGGTGAAGGAACGGGTG
Enzymes
  
Accessions and product sizes
Approximate temperature
50°C
  
Genomic location of SSR42  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D715 marker 715
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)