SGN Marker SSR43

SGN-M716

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 42.857 High: 40
Repeat motif: TAC   Repeat number: 7
Repeat motif:    Repeat number:
Forward primer: CTCCAAATTGGGCAATAACA
Reverse primer: TTAGGAAGTTGCATTAGGCCA
Predicted size: 237
Derivations 
This marker was derived from EST read SGN-E95596
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49371)
Chromosome
4
Position
2.13 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47306)
Chromosome
4
Position
11.68 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Sun1642 x LA1589   
Map version
85 (location: 43807)
Chromosome
4
Position
24.90 cM
Confidence
uncalculated
Protocol
SSR


Sun1642 x LA1589

PCR data   Exp. ID 44819
Forward primer (5'-3')
CTCCAAATTGGGCAATAACA
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TTAGGAAGTTGCATTAGGCCA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43267)
Chromosome
4
Position
24.90 cM
Confidence
uncalculated
Protocol
SSR


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

PCR data   Exp. ID 44633
Forward primer (5'-3')
CTCCAAATTGGGCAATAACA
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TTAGGAAGTTGCATTAGGCCA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40767)
Chromosome
4
Position
15.00 cM
Confidence
uncalculated
Protocol
SSR


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39244)
Chromosome
4
Position
14.00 cM
Confidence
F(LOD3)
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 57
Forward primer (5'-3')
CTCCAAATTGGGCAATAACA
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTAGGAAGTTGCATTAGGCCA
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 237+237
Solanum pennellii LA716: 228+237
Approximate temperature
50°C
  
Overgo hybridization and physical mapping 
SSR43 was used as an overgo probe on plate 6 [well F11]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CGACAGCTTCATCACACATAGAGC
B sequence
CAAGGCATCACAAAAGGCTCTATG
AB sequence
CGACAGCTTCATCACACATAGAGCCTTTTG
Marker sequence
TTCACGTTTACCATAATATCTGTACGAAATTCACCTGCGGAGAAAGAGGA
TTACACGGTGGGAATCGAACCCCACCCACAAAATCTTCAAGAGTAACCAA
CTAACCGAACAACTAAAATTCTCCTTTTTCTTTTTTTTAGCTTGAGTTTG
TGTACTACTATTAGGAATTTAATTTATACATATTAACGCCTTGCACTTTC
CTTCTTTCTTGCTATCATATATATACATATTTCTTATATTGTCAGTATAT
ATAACTGTTTACCCTCGTATATATTCTTTTTTGTCGTGTTTACACAGGCG
CGACAGCTTCATCACACATAGAGCCTTTTGTGATGCCTTGGTTCAAGAAA
ATGCAAGAAATATCCTTTCACCAAACTCCTTGATGAACACCCTTGGCATG
AACAACAACCAATATTTATATGGAAGTAGTAGCAACATAAACTTAGGCAC
CTTCTCCAAATTGGGCAATAACAACAACATCACAAAGACTACTACTACTA
CTACAACTACTACTAGTGGTGTTCAATTTGATCATCATCATCATGACAAC
AACCTCATTGGATCAAGTACTACTACTACTACTACTACTAACAATCCCTT
TTTCCTTCAAGATACAAATCAAGATCATTACAATGCCAACAACAACAATA
TCAAACCATTAATGGTCCATGGCCTAATGCAACTTCCTAATCTTGATCAT
AACAACAACAATAGTAGTAGTAGTACTACTATGTTTAACCCTAACTTTTT
TCAAAACAATTTGTCTACCAATAGTGGAAATTTTGGG
Genomic location of SSR43  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D716 marker 716
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)