SGN Marker C2_At2g04700

SGN-M7166
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U204561---
Lycopersicon CombinedSingleSGN-U215038---
Solanum tuberosumSingleSGN-U247828---
ArabidopsisSingleAt2g04700 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49225)
Chromosome
2
Position
44.26 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47156)
Chromosome
2
Position
104.00 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46626)
Chromosome
2
Position
7.90 cM
Confidence
I(LOD2)
Protocol
PCR


Tobacco N. tomentosiformis

Map: Tobacco N. acuminata   
Map version
89 (location: 46458)
Chromosome
2
Position
18.30 cM
Confidence
I(LOD2)
Protocol
dCAPS


Tobacco N. acuminata

Map: Pepper-COSII   
Map version
58 (location: 41367)
Chromosome
2
Position
128.80 cM
Confidence
I(LOD2)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43343
Forward primer (5'-3')
ATGAGAACTCTTCAAGCTTCCACCTC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TGACCACAGAAGTAACACCTTTGTCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38291)
Chromosome
2
Position
97.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39556
Forward primer (5'-3')
ATGAGAACTCTTCAAGCTTCCACCTC
Accessions and product sizes
Solanum lycopersicum TA209
1200
Solanum pennellii TA56
950
Approximate temperature
55°C
Reverse primer (5'-3')
TGACCACAGAAGTAACACCTTTGTCC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
1200
Solanum pennellii TA56
950
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25581)
Chromosome
2
Position
1.65 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10516
Forward primer (5'-3')
ATGAGAACTCTTCAAGCTTCCACCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGACCACAGAAGTAACACCTTTGTCC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 780
Approximate temperature
55°C
  
PCR data   Exp. ID 10517
Forward primer (5'-3')
ATGAGAACTCTTCAAGCTTCCACCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGACCACAGAAGTAACACCTTTGTCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 780
Approximate temperature
55°C
  
PCR data   Exp. ID 10518
Forward primer (5'-3')
ATGAGAACTCTTCAAGCTTCCACCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGACCACAGAAGTAACACCTTTGTCC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 780
Approximate temperature
55°C
  
PCR data   Exp. ID 10519
Forward primer (5'-3')
ATGAGAACTCTTCAAGCTTCCACCTC
Digested band sizes (using HinfI)
Solanum pennellii LA716: 780
Solanum lycopersicum LA925: 650
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGACCACAGAAGTAACACCTTTGTCC
Enzymes
All possible enzymes for pennellii and and lycopersicum: AluI,AseI,BclI,BglII,BstUI,BstYI,HinfI
All possible enzymes for lycopersicum and pimpinellifolium: AluI,BglII,BstUI,BstYI
  
Accessions and product sizes
Solanum lycopersicum LA925: 780
Solanum pennellii LA716: 780
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At2g04700F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, plain text
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text


Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At2g04700F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, plain text
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At2g04700  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7166 marker 7166
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)