SGN Marker SSR44

SGN-M717

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 55 High: 45
Repeat motif: GA   Repeat number: 54
Repeat motif:    Repeat number:
Forward primer: TCATCTGCAATTCATGGCTC
Reverse primer: AGGTCAAGGATGTGCTTCCC
Predicted size: 220
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39245)
Chromosome
12
Position
60.00 cM
Confidence
CF(LOD3)
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 31871
Forward primer (5'-3')
TCATCTGCAATTCATGGCTC
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
AGGTCAAGGATGTGCTTCCC
Enzymes
  
Accessions and product sizes
Approximate temperature
45°C
  
Overgo hybridization and physical mapping 
SSR44 was used as an overgo probe on plate 1 [well D9]

Plausible BAC Matches:   P162K13,   P167L12,   P197O22,   P171L13

 Overgo Sequences

A sequence
GTATCCCAATGGCTGAAAGGTACG
B sequence
CTCTCTCTCTCTCTCTCGTACCTT
AB sequence
GTATCCCAATGGCTGAAAGGTACGAGAGAG
Marker sequence
CACAAGCAATTTCTTTGCTGGAACAAATTGTTCTTTGTCTCTGTGAAATT
AATCTCTCTTTGTTGTAGAAATGGCTTTGACTTTCACTTCTTCATCTGCA
ATTCATGGCTCTTTGTCTTCTTCATCTTCTTCTTATGAACAACCCAAAGT
ATCCCAATGGCTGAAAGGTACGAGAGAGAGAGAGAGAGAGAGAGAGAGAG
AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG
AGAGAGAGAGAGAGAGAGAGAGAGAGAGATAGACCGTGCCAGGGAAGCAC
ATCCTTGACCTTACCTCCATT
Genomic location of SSR44  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D717 marker 717
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)