SGN Marker C2_At2g06010

SGN-M7179
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U205516---
Lycopersicon CombinedSingleSGN-U219488---
Solanum tuberosumMultipleSGN-U247736---
ArabidopsisSingleAt2g06010 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38295)
Chromosome
12
Position
32.70 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39560
Forward primer (5'-3')
TGCAGGCAACAGGTTGGAAATGG
Accessions and product sizes
Solanum lycopersicum TA209
1650
Solanum pennellii TA56
1650
Approximate temperature
53°C
Reverse primer (5'-3')
AGATGGCCTCCACTCTATCCAGTGAC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25594)
Chromosome
2
Position
2.34 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10531
Forward primer (5'-3')
TGCAGGCAACAGGTTGGAAATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGATGGCCTCCACTCTATCCAGTGAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 10532
Forward primer (5'-3')
TGCAGGCAACAGGTTGGAAATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGATGGCCTCCACTCTATCCAGTGAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 10533
Forward primer (5'-3')
TGCAGGCAACAGGTTGGAAATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGATGGCCTCCACTCTATCCAGTGAC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 10534
Forward primer (5'-3')
TGCAGGCAACAGGTTGGAAATGG
Digested band sizes (using MspI)
Solanum pennellii LA716: 50+150+200
Solanum lycopersicum LA925: 300
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGATGGCCTCCACTCTATCCAGTGAC
Enzymes
All possible enzymes for pennellii and and lycopersicum: BslI,HinfI,MspI
All possible enzymes for lycopersicum and pimpinellifolium: HinfI,MspI
  
Accessions and product sizes
Solanum pennellii LA716: 400
Solanum lycopersicum LA925: 400
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At2g06010F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, PDF chromatogram
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, PDF chromatogram
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, PDF chromatogram
Forward amplicon sequence for S. pennellii TA56, plain text
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At2g06010  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7179 marker 7179
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)