SGN Marker SSR45

SGN-M718

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 50 High: 50
Repeat motif: AAT   Repeat number: 14
Repeat motif:    Repeat number:
Forward primer: TGTATCCTGGTGGACCAATG
Reverse primer: TCCAAGTATCAGGCACACCA
Predicted size: 246
Derivations 
This marker was derived from EST read SGN-E93019
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53500)
Chromosome
7
Position
83.91 cM
Confidence
uncalculated
Protocol
SSR


Tomato-EXPIMP 2009

Map: Sun1642 x LA1589   
Map version
85 (location: 43808)
Chromosome
7
Position
75.50 cM
Confidence
uncalculated
Protocol
SSR


Sun1642 x LA1589

PCR data   Exp. ID 44820
Forward primer (5'-3')
TGTATCCTGGTGGACCAATG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TCCAAGTATCAGGCACACCA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43268)
Chromosome
7
Position
68.80 cM
Confidence
uncalculated
Protocol
SSR


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

PCR data   Exp. ID 44634
Forward primer (5'-3')
TGTATCCTGGTGGACCAATG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TCCAAGTATCAGGCACACCA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40768)
Chromosome
7
Position
80.00 cM
Confidence
uncalculated
Protocol
SSR


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39247)
Chromosome
7
Position
60.00 cM
Confidence
F(LOD3)
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 94
Forward primer (5'-3')
TGTATCCTGGTGGACCAATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAAGTATCAGGCACACCA
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 246+248
Solanum pennellii LA716: 246+275
Approximate temperature
50°C
  
Overgo hybridization and physical mapping 
SSR45 was used as an overgo probe on plate 7 [well D10]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GGAGAGACACAACCAATTAGTGGC
B sequence
CACCAGGATACACTGAGCCACTAA
AB sequence
GGAGAGACACAACCAATTAGTGGCTCAGTG
Marker sequence
AACGGCGACGCTTGGAAAGGATTCGACATGCTCATTTTCAATACTTGGCA
TTGGTGGCTCCACAAGGGAAGCCAACAATCATGGGATTTTATACAAAAAG
GAGATCAAATATATAAAGACATGGATCGTTTAGTGGCCTTTAAAGAGGGA
CTTAAAACTTGGTCCAATTGGGTAGAATCATATATTGATCCAACCAAAAC
AAGAGTATTCTTTCAAGGCATTTCTCCTACACATTATAGTGGGCAAGAAT
GGAATGCTAGCAAACCAAGTAGCAATTGCAATGGAGAGACACAACCAATT
AGTGGCTCAGTGTATCCTGGTGGACCAATGGCAGCAGCAACAATTGTGAA
AGAAATTATTGGCAATATGTCAAAACAAGTGACATTACTTGACATTACAT
TACTATCTCAACTAAGAAAAGATGGACACCCTTCAATTTATGGTATGAAT
AATAATAATAATAATAATAATAATAATAATAATAATAATGATACAAAGAT
CAAAAAGGGTAATGATTGTAGTCATTGGTGTCTTGCTGGTGTGCCTGATA
CTTGGAATCAACTCTTTTATGCTCTTCTTCT
Genomic location of SSR45  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D718 marker 718
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)