SGN Marker C2_At2g06050

SGN-M7181
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle300552 (SGN)
123428 (CGN)
---
Capsicum annuumSingleSGN-U198033---
Lycopersicon CombinedMultipleSGN-U214814---
Solanum tuberosumSingleSGN-U246679---
ArabidopsisSingleAt2g06050 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 25596)
Chromosome
2
Position
2.36 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41199
Forward primer (5'-3')
TGCCAGGGATTTTCACAAAGGAAC
Accessions and product sizes
Solanum lycopersicum TA209
100
Solanum pennellii TA56
100
Approximate temperature
55°C
Reverse primer (5'-3')
AGATGCACGACCAACATGCCACAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  
Other PCR data 
PCR data   Exp. ID 10538
Forward primer (5'-3')
TGCCAGGGATTTTCACAAAGGAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGATGCACGACCAACATGCCACAG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 100
Approximate temperature
53°C
  
PCR data   Exp. ID 10539
Forward primer (5'-3')
TGCCAGGGATTTTCACAAAGGAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGATGCACGACCAACATGCCACAG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 100
Approximate temperature
53°C
  
PCR data   Exp. ID 10540
Forward primer (5'-3')
TGCCAGGGATTTTCACAAAGGAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGATGCACGACCAACATGCCACAG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 100
Approximate temperature
53°C
  
PCR data   Exp. ID 12240
Forward primer (5'-3')
TCGGCCTTGAATGCTATTGAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAAGGAAAGGGTAATCTGTGTATCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 12241
Forward primer (5'-3')
TCGGCCTTGAATGCTATTGAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAAGGAAAGGGTAATCTGTGTATCC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 1150
Approximate temperature
55°C
  
PCR data   Exp. ID 12242
Forward primer (5'-3')
TCGGCCTTGAATGCTATTGAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAAGGAAAGGGTAATCTGTGTATCC
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 12243
Forward primer (5'-3')
TCGGCCTTGAATGCTATTGAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAAGGAAAGGGTAATCTGTGTATCC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 12244
Forward primer (5'-3')
TCGGCCTTGAATGCTATTGAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAAGGAAAGGGTAATCTGTGTATCC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 12245
Forward primer (5'-3')
TCGGCCTTGAATGCTATTGAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAAGGAAAGGGTAATCTGTGTATCC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 12246
Forward primer (5'-3')
TCGGCCTTGAATGCTATTGAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAAGGAAAGGGTAATCTGTGTATCC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 12247
Forward primer (5'-3')
TCGGCCTTGAATGCTATTGAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAAGGAAAGGGTAATCTGTGTATCC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 12248
Forward primer (5'-3')
TCGGCCTTGAATGCTATTGAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAAGGAAAGGGTAATCTGTGTATCC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 12249
Forward primer (5'-3')
TCGGCCTTGAATGCTATTGAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAAGGAAAGGGTAATCTGTGTATCC
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 1050
Approximate temperature
55°C
  
PCR data   Exp. ID 12250
Forward primer (5'-3')
TCGGCCTTGAATGCTATTGAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAAGGAAAGGGTAATCTGTGTATCC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 900+1100
Approximate temperature
55°C
  
PCR data   Exp. ID 12251
Forward primer (5'-3')
TCGGCCTTGAATGCTATTGAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAAGGAAAGGGTAATCTGTGTATCC
Enzymes
  
Accessions and product sizes
Coffea canephora BP409: 1300+1700
Approximate temperature
55°C
  
PCR data   Exp. ID 33332
Forward primer (5'-3')
TCGGCCTTGAATGCTATTGAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAAGGAAAGGGTAATCTGTGTATCC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 33333
Forward primer (5'-3')
TCGGCCTTGAATGCTATTGAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAAGGAAAGGGTAATCTGTGTATCC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 33334
Forward primer (5'-3')
TCGGCCTTGAATGCTATTGAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAAGGAAAGGGTAATCTGTGTATCC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 33335
Forward primer (5'-3')
TCGGCCTTGAATGCTATTGAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAAGGAAAGGGTAATCTGTGTATCC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 850
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Genomic location of C2_At2g06050  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7181 marker 7181
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)