SGN Marker TG1

SGN-M72

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
700
Vector
pUC
Cutting Site
EcoR1/HindIII
Drug Resistance
AMP
Image
Forward sequence
AACCTAAAGGAATGCCCACCAAAGAAGGTTCACAAGTTAAAGAGATAATATCTCACGTGGCCACTCAACTAATGATTTTTCTCTTACAAA
GGCAATCAGTTTCCCACATTGCTCCTTCGGGAGGTTATCCTTCACGAATCTTCGCTTCCCTTAGATACTACAGCTTTACTAGTTAGGGGC
ATTTGTAATGTGATCATGTTTCTGCCTATCCGTTTGTTCTTTAATAACTTTTTCAAACTCTACAAATGAGAGTATTTTTGTTCTCCCTAG
CCTTCTCATAGTCCCCCTCCTATTTTCATCTCTGGAAGCAAGAATATTTGCTGGTCATTGTATGCTAAGAACTTCATTGACTGTGTTCCG
GAACTTTTTGGTTATATGCAATACAAAAAGCAGCCAGAAAAAGAACAACACAATGAGTCTGAGAAACTTCAGTCACATCTCCGCTACATC
TCAAAAAATCAATGTGTCATCAGAAATTCAGCATAAAAAATGTGTGAC
Reverse sequence
AGCATTTCCTATATCTTTTGGAAGTTACACATGGGATGTGGCATCACCACATACAAGTTCTCAATTCTAACTAATGGTAATGATTCTTAC
CTTCTCCGAGGGGATTGAGGTAAGCAGATCGTTTGTCACCCTTACTGTGATGGAGGGACCTCAGCAAGATGCTGGGGATCTACTTTGAGG
AGGAGATGGGATAATAATATAAGAGTTTGGACATAAATGGCGCTCAAGAGAACATGTCACACATTTTTTATGCTGAATTTCTGATGACAC
ATTGATTTTTTGAGATGTAGCGGAGATGTGACTGAAGTTTCTCAGACTCATTGTGTTGTTCTTTTTCTGGCTGCTTTTTGTATTGCATAT
AACCAAAAAGTTCCGGAACACAGTCAATGAAGTTCTTAGCATACAATGACCAGCAAATATTCTTGCTTCCAGAGATGAAAATAGGAGGGG
GACTATGAGAAGGCTAGGGAGAACAAAAATACTCTCATTTGTAGAGTTTGAAAAAGTTATTAAAGAACAAACGGATAGGCAGAAACA
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato QTL map   
Map version
137 (location: 53851)
Chromosome
10
Position
58.80 cM
Confidence
uncalculated
Protocol
RFLP


Tomato QTL map

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53152)
Chromosome
2
Position
61.07 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_2 MQTL_2_Late_blight_2 MQTL_3_Late_blight_2
Potato meta-QTL consensus map

Map: Tomato-EXPEN 1992   
Map version
28 (location: 7958)
Chromosome
10
Position
62.00 cM
Confidence
I
Protocol
RFLP
Subscript
A


Tomato-EXPEN 1992

Map: Tomato-EXPEN 1992   
Map version
28 (location: 7957)
Chromosome
2
Position
33.00 cM
Confidence
I
Protocol
RFLP
Subscript
B


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 7960)
Chromosome
2
Position
6.70 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
B


Potato-TXB 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 7959)
Chromosome
10
Position
89.00 cM
Confidence
F(LOD3)
Protocol
RFLP
Subscript
A


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG1 was used as an overgo probe on plate 14 [well B8]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P197N11,   P310E21,   P089O22

 Overgo Sequences

A sequence
GCAATCAGTTTCCCACATTGCTCC
B sequence
AGGATAACCTCCCGAAGGAGCAAT
AB sequence
GCAATCAGTTTCCCACATTGCTCCTTCGGG
Marker sequence
AACCTAAAGGAATGCCCACCAAAGAAGGTTCACAAGTTAAAGAGATAATA
TCTCACGTGGCCACTCAACTAATGATTTTTCTCTTACAAAGGCAATCAGT
TTCCCACATTGCTCCTTCGGGAGGTTATCCTTCACGAATCTTCGCTTCCC
TTAGATACTACAGCTTTACTAGTTAGGGGCATTTGTAATGTGATCATGTT
TCTGCCTATCCGTTTGTTCTTTAATAACTTTTTCAAACTCTACAAATGAG
AGTATTTTTGTTCTCCCTAGCCTTCTCATAGTCCCCCTCCTATTTTCATC
TCTGGAAGCAAGAATATTTGCTGGTCATTGTATGCTAAGAACTTCATTGA
CTGTGTTCCGGAACTTTTTGGTTATATGCAATACAAAAAGCAGCCAGAAA
AAGAACAACACAATGAGTCTGAGAAACTTCAGTCACATCTCCGCTACATC
TCAAAAAATCAATGTGTCATCAGAAATTCAGCATAAAAAATGTGTGAC
Genomic location of TG1  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D72 marker 72
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)