SGN Marker SSR47

SGN-M720

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 42.857 High: 40.909
Repeat motif: AT   Repeat number: 14
Repeat motif:    Repeat number:
Forward primer: TCCTCAAGAAATGAAGCTCTGA
Reverse primer: CCTTGGAGATAACAACCACAA
Predicted size: 191
Derivations 
This marker was derived from EST read SGN-E92362
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39250)
Chromosome
6
Position
6.50 cM
Confidence
I(LOD2)
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 77
Forward primer (5'-3')
TCCTCAAGAAATGAAGCTCTGA
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
CCTTGGAGATAACAACCACAA
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 191+191
Solanum pennellii LA716: 180+191
Approximate temperature
50°C
  
Overgo hybridization and physical mapping 
SSR47 was used as an overgo probe on plate 1 [well C4]

Plausible BAC Matches:   P318G15,   P286B18,   P263A24,   P214J08,   P219C13,   P062M18,   P139L03,   P067A09,   P327C18,   P303N06,   P150M10,   P302C18

 Overgo Sequences

A sequence
ACCGGGCCATTTTACTCTAGCACT
B sequence
GACCCGGTTCAATACTAGTGCTAG
AB sequence
ACCGGGCCATTTTACTCTAGCACTAGTATT
Marker sequence
ATATAAATAAATACATTCAAAATTTATTCATGATAAAGATCAAACTTATA
TTGGCACTACATTCATTGACATTAACAATTCCTCAAGAAATGAAGCTCTG
ACATCAAATTTCTCACAAAAAGAAATATTATAATATATATATATATATAT
ATATATATATTCTCAATAGGAAAACAAGCTAAAACAACATATGCTAAGAA
AAATCTTAACACATGAACATATGCAAGCAATGAACCAGACTAGTAACTAT
TGTGGTTGTTATCTCCAAGGTATATATATTAATAAATACCCCATAAGTTG
TTGATATTTTTGATAAAAATTATATTAATAAATACCCTATAAGATAAACC
CTCAGCGGTCGCTGATTTAAAATAATGTATTCAAGAGGAAGTCAAACCAG
AATAAAATGGCACCCCGGTAGCAGGTATCCACTCACTCCCTTGAATAAAA
TTTCCAACAGTGAATTGACTGGCCTCACTAGAGCTATTAATGACCCGATA
ACCGGGCCATTTTACTCTAGCACTAGTATTGAACCGGGTCCC
Genomic location of SSR47  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D720 marker 720
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)