SGN Marker SSR48

SGN-M721

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 50 High: 50
Repeat motif: CAC   Repeat number: 7
Repeat motif:    Repeat number:
Forward primer: ATCTCCTTGGCCTCCTGTTT
Reverse primer: GTCATGGCCACATGAATACG
Predicted size: 199
Derivations 
This marker was derived from EST read SGN-E177066
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39253)
Chromosome
6
Position
6.00 cM
Confidence
I(LOD2)
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 32111
Forward primer (5'-3')
ATCTCCTTGGCCTCCTGTTT
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
GTCATGGCCACATGAATACG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 199
Approximate temperature
50°C
  
Overgo hybridization and physical mapping 
SSR48 was used as an overgo probe on plate 2 [well E1]

Plausible BAC Matches:   P181H03,   P166G24,   P282H10,   P055F06

 Non-Plausible BAC matches

P118F10,   P209F08,   P181K18,   P290A21,   P252E12

 Overgo Sequences

A sequence
GGCCTTTTGGACTTCTCATCTCCT
B sequence
GAAAAACAGGAGGCCAAGGAGATG
AB sequence
GGCCTTTTGGACTTCTCATCTCCTTGGCCT
Marker sequence
GGGATGGCCTTTTGGACTTCTCATCTCCTTGGCCTCCTGTTTTTCTTTCT
ACTAATTATCAATCAAATTTCCTTCATCACCACCACCACCACCACCACCC
GCGTTGGCGTTATCTTGAAACCAACTTTCCTACATGTTCCCGTCTTTCGG
GAAGCGCCTGCTTTTCGCAATGGGAGGGATTGTGGTTCGTCCGCTGCGGA
CCGTATTCATGTGGCCATGACTCTTGATGCTAATTATTTGAGAGGTATTG
TTGTTGAAATGTACCATGGCTGCAGTATTATCCATCCTACAACATTCAAC
ATGTCCAGAAGATGTCATGTTTCACTTTTTATGTGTAAGACATGAACCTG
TGGTATTTTCTAGCATTAAGTCCACTTTCCCTTACCTCAACTTCAAGCTC
TACAAATTTGATGT
Genomic location of SSR48  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D721 marker 721
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)