SGN Marker C2_At2g18030

SGN-M7222
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeMultiple299295 (SGN)
123600 (CGN)
---
Lycopersicon CombinedSingleSGN-U219324---
Solanum tuberosumSingleSGN-U255329---
ArabidopsisSingleAt2g18030 on TAIR---
Mapped locations  
Map: Solanum michoacanum 2011   
Map version
155 (location: 109226)
Chromosome
2
Position
69.28 cM
Confidence
uncalculated
Protocol
CAPS


Solanum michoacanum 2011

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38307)
Chromosome
2
Position
83.10 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39569
Forward primer (5'-3')
TTGGGCGACCACGCTGAATC
Accessions and product sizes
Solanum lycopersicum TA209
500
Solanum pennellii TA56
500
Approximate temperature
55°C
Reverse primer (5'-3')
TTACCCACATCAGGACCTTGCC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
400
Solanum pennellii TA56
500
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25638)
Chromosome
2
Position
7.85 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10577
Forward primer (5'-3')
TTGGGCGACCACGCTGAATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTACCCACATCAGGACCTTGCC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 10578
Forward primer (5'-3')
TTGGGCGACCACGCTGAATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTACCCACATCAGGACCTTGCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 43762
Forward primer (5'-3')
TTGGGCGACCACGCTGAATC
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TTACCCACATCAGGACCTTGCC
Enzymes
  
Accessions and product sizes
Approximate temperature
60°C
  
PCR data   Exp. ID 10579
Forward primer (5'-3')
TTGGGCGACCACGCTGAATC
Digested band sizes (using amplicon difference)
Solanum pennellii LA716: 1300
Solanum lycopersicum LA925: 1200
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTACCCACATCAGGACCTTGCC
Enzymes
All possible enzymes for pennellii and and lycopersicum: amplicon difference
  
Accessions and product sizes
Solanum pennellii LA716: 1300
Solanum lycopersicum LA925: 1200
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At2g18030  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7222 marker 7222
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)