SGN Marker C2_At2g18710

SGN-M7230
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle303383 (SGN)
125042 (CGN)
---
Capsicum annuumSingleSGN-U203635---
Lycopersicon CombinedMultipleSGN-U216247---
Solanum tuberosumSingleSGN-U252384---
ArabidopsisSingleAt2g18710 on TAIR---
Mapped locations  
Map: Eggplant-COSII   
Map version
63 (location: 42198)
Chromosome
7
Position
9.80 cM
Confidence
F(LOD3)
Protocol
CAPS


Eggplant-COSII

PCR data   Exp. ID 43763
Forward primer (5'-3')
TAAAAGCACAGCGGCATTCATC
Accessions and product sizes
Approximate temperature
53°C
Reverse primer (5'-3')
AGAACCAAGAACTGATATCCGGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-COSII   
Map version
58 (location: 41372)
Chromosome
7
Position
0.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43348
Forward primer (5'-3')
TAAAAGCACAGCGGCATTCATC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AGAACCAAGAACTGATATCCGGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38309)
Chromosome
7
Position
0.10 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39571
Forward primer (5'-3')
TAAAAGCACAGCGGCATTCATC
Accessions and product sizes
Solanum pennellii TA56
900
Solanum lycopersicum TA209
900
Approximate temperature
55°C
Reverse primer (5'-3')
AGAACCAAGAACTGATATCCGGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25646)
Chromosome
2
Position
8.12 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10587
Forward primer (5'-3')
TAAAAGCACAGCGGCATTCATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAACCAAGAACTGATATCCGGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1150
Approximate temperature
55°C
  
PCR data   Exp. ID 10588
Forward primer (5'-3')
TAAAAGCACAGCGGCATTCATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAACCAAGAACTGATATCCGGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1150
Approximate temperature
55°C
  
PCR data   Exp. ID 10589
Forward primer (5'-3')
TAAAAGCACAGCGGCATTCATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAACCAAGAACTGATATCCGGC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1150
Approximate temperature
55°C
  
PCR data   Exp. ID 12938
Forward primer (5'-3')
TAAAAGCACAGCGGCATTCATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAACCAAGAACTGATATCCGGC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 12939
Forward primer (5'-3')
TAAAAGCACAGCGGCATTCATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAACCAAGAACTGATATCCGGC
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 12940
Forward primer (5'-3')
TAAAAGCACAGCGGCATTCATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAACCAAGAACTGATATCCGGC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 1350
Approximate temperature
55°C
  
PCR data   Exp. ID 12941
Forward primer (5'-3')
TAAAAGCACAGCGGCATTCATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAACCAAGAACTGATATCCGGC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 12942
Forward primer (5'-3')
TAAAAGCACAGCGGCATTCATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAACCAAGAACTGATATCCGGC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 12943
Forward primer (5'-3')
TAAAAGCACAGCGGCATTCATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAACCAAGAACTGATATCCGGC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 12944
Forward primer (5'-3')
TAAAAGCACAGCGGCATTCATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAACCAAGAACTGATATCCGGC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 12945
Forward primer (5'-3')
TAAAAGCACAGCGGCATTCATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAACCAAGAACTGATATCCGGC
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 12946
Forward primer (5'-3')
TAAAAGCACAGCGGCATTCATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAACCAAGAACTGATATCCGGC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 12947
Forward primer (5'-3')
TAAAAGCACAGCGGCATTCATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAACCAAGAACTGATATCCGGC
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 1250
Approximate temperature
55°C
  
PCR data   Exp. ID 12948
Forward primer (5'-3')
TAAAAGCACAGCGGCATTCATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAACCAAGAACTGATATCCGGC
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 700+1200
Approximate temperature
55°C
  
PCR data   Exp. ID 12949
Forward primer (5'-3')
TAAAAGCACAGCGGCATTCATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAACCAAGAACTGATATCCGGC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 1250
Approximate temperature
55°C
  
PCR data   Exp. ID 12950
Forward primer (5'-3')
TAAAAGCACAGCGGCATTCATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAACCAAGAACTGATATCCGGC
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 1250
Approximate temperature
55°C
  
PCR data   Exp. ID 12951
Forward primer (5'-3')
TAAAAGCACAGCGGCATTCATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAACCAAGAACTGATATCCGGC
Enzymes
  
Accessions and product sizes
Coffea canephora BP409: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 32907
Forward primer (5'-3')
TAAAAGCACAGCGGCATTCATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAACCAAGAACTGATATCCGGC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 32908
Forward primer (5'-3')
TAAAAGCACAGCGGCATTCATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAACCAAGAACTGATATCCGGC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 32909
Forward primer (5'-3')
TAAAAGCACAGCGGCATTCATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAACCAAGAACTGATATCCGGC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 32910
Forward primer (5'-3')
TAAAAGCACAGCGGCATTCATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAACCAAGAACTGATATCCGGC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 10590
Forward primer (5'-3')
TAAAAGCACAGCGGCATTCATC
Digested band sizes (using HinfI)
Solanum lycopersicum LA925: 900
Solanum pennellii LA716: 600
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAACCAAGAACTGATATCCGGC
Enzymes
All possible enzymes for pennellii and and lycopersicum: HinfI
  
Accessions and product sizes
Solanum pennellii LA716: 1150
Solanum lycopersicum LA925: 1150
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. quitoense plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #1, plain text
Forward amplicon sequence for S. betaceum 04T130, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T130, plain text
Forward amplicon sequence for S. betaceum 04T132, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T132, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text

Genomic location of C2_At2g18710  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7230 marker 7230
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)