SGN Marker SSR52

SGN-M725

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 50 High: 50
Repeat motif: AAC   Repeat number: 9
Repeat motif:    Repeat number:
Forward primer: TGATGGCAGCATCGTAGAAG
Reverse primer: GGTGCGAAGGGATTTACAGA
Predicted size: 202
Derivations 
This marker was derived from EST read SGN-E172997
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39258)
Chromosome
7
Position
3.00 cM
Confidence
F(LOD3)
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 88
Forward primer (5'-3')
TGATGGCAGCATCGTAGAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
GGTGCGAAGGGATTTACAGA
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 202+202
Solanum lycopersicum LA925: 190+202
Approximate temperature
50°C
  
Overgo hybridization and physical mapping 
SSR52 was used as an overgo probe on plate 7 [well F8]

Plausible BAC Matches:   P007D04

 Overgo Sequences

A sequence
ATCATCTCCGTCACACGGATGATG
B sequence
TCTTCTACGATGCTGCCATCATCC
AB sequence
ATCATCTCCGTCACACGGATGATGGCAGCA
Marker sequence
CGACTACAGGCTGTTCATCATCTCCGTCACACGGATGATGGCAGCATCGT
AGAAGAAATTATGGACCAAACACCAACTCCTTCATCAACCATAACTGCAG
ATTCTTCCCTCTCATCTCAACCTCTTCATTCTTCTTCCCCAAACAACAAC
AACAACAACAACAACAACAATCATATTCTCGAAATCACCCTCATTTCTGC
TCAAGATCTATCTCCCGTCTGTAAATCCCTTCGCACCTACGCGTTAACTT
GGGTTAATCCCAATCGTAAACGCACAACTCGTATTGATAATCATGGTCAC
AATAACCCCAATTGGAATGATAAGTTCTCTTT
Genomic location of SSR52  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D725 marker 725
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)