SGN Marker C2_At2g20820

SGN-M7253
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U197259---
Lycopersicon CombinedSingleSGN-U222188---
Solanum tuberosumSingleSGN-U266532---
ArabidopsisSingleAt2g20820 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 25668)
Chromosome
2
Position
8.97 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41221
Forward primer (5'-3')
ATGGCTACCTCGTTGACAATGGC
Accessions and product sizes
Solanum lycopersicum TA209
1050
Solanum pennellii TA56
1050
Approximate temperature
55°C
Reverse primer (5'-3')
TGATGCTTGCACCAAGTTCTCTTC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
400+650
Solanum lycopersicum TA209
1050
Mg+2 concentration
1.5mM
   Enzymes
  
Other PCR data 
PCR data   Exp. ID 10608
Forward primer (5'-3')
ATGGCTACCTCGTTGACAATGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATGCTTGCACCAAGTTCTCTTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 480
Approximate temperature
55°C
  
PCR data   Exp. ID 10609
Forward primer (5'-3')
ATGGCTACCTCGTTGACAATGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATGCTTGCACCAAGTTCTCTTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 10610
Forward primer (5'-3')
ATGGCTACCTCGTTGACAATGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATGCTTGCACCAAGTTCTCTTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 480
Approximate temperature
55°C
  
PCR data   Exp. ID 32236
Forward primer (5'-3')
ATGGCTACCTCGTTGACAATGGC
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
TGATGCTTGCACCAAGTTCTCTTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 480
Approximate temperature
53°C
  
PCR data   Exp. ID 32237
Forward primer (5'-3')
ATGGCTACCTCGTTGACAATGGC
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
TGATGCTTGCACCAAGTTCTCTTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 480
Approximate temperature
53°C
  
PCR data   Exp. ID 32238
Forward primer (5'-3')
ATGGCTACCTCGTTGACAATGGC
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
TGATGCTTGCACCAAGTTCTCTTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 480
Approximate temperature
53°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At2g20820  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7253 marker 7253
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)