SGN Marker C2_At2g20860

SGN-M7256
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle307971 (SGN)
128374 (CGN)
---
Capsicum annuumSingleSGN-U200809---
Lycopersicon CombinedMultipleSGN-U217893---
Solanum tuberosumSingleSGN-U248450---
ArabidopsisSingleAt2g20860 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46630)
Chromosome
8
Position
22.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tobacco N. acuminata   
Map version
89 (location: 46460)
Chromosome
8
Position
6.40 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. acuminata

Map: Pepper-COSII   
Map version
58 (location: 41373)
Chromosome
7
Position
75.70 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43349
Forward primer (5'-3')
ATTGAAGCCACATATACTCATAGAAGC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TCCAGATTTTGCAACTTTCTCTACAC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38314)
Chromosome
7
Position
43.30 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39575
Forward primer (5'-3')
ATTGAAGCCACATATACTCATAGAAGC
Accessions and product sizes
Solanum lycopersicum TA209
850
Solanum pennellii TA56
1650
Approximate temperature
55°C
Reverse primer (5'-3')
TCCAGATTTTGCAACTTTCTCTACAC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
1650
Solanum lycopersicum TA209
850
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25671)
Chromosome
2
Position
8.99 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10611
Forward primer (5'-3')
ATTGAAGCCACATATACTCATAGAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAGATTTTGCAACTTTCTCTACAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1350
Approximate temperature
55°C
  
PCR data   Exp. ID 10612
Forward primer (5'-3')
ATTGAAGCCACATATACTCATAGAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAGATTTTGCAACTTTCTCTACAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1350
Approximate temperature
55°C
  
PCR data   Exp. ID 10613
Forward primer (5'-3')
ATTGAAGCCACATATACTCATAGAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAGATTTTGCAACTTTCTCTACAC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1350
Approximate temperature
55°C
  
PCR data   Exp. ID 12952
Forward primer (5'-3')
ATTGAAGCCACATATACTCATAGAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAGATTTTGCAACTTTCTCTACAC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 680
Approximate temperature
55°C
  
PCR data   Exp. ID 12953
Forward primer (5'-3')
ATTGAAGCCACATATACTCATAGAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAGATTTTGCAACTTTCTCTACAC
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 680
Approximate temperature
55°C
  
PCR data   Exp. ID 12954
Forward primer (5'-3')
ATTGAAGCCACATATACTCATAGAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAGATTTTGCAACTTTCTCTACAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 12955
Forward primer (5'-3')
ATTGAAGCCACATATACTCATAGAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAGATTTTGCAACTTTCTCTACAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 1100+680
Approximate temperature
55°C
  
PCR data   Exp. ID 12956
Forward primer (5'-3')
ATTGAAGCCACATATACTCATAGAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAGATTTTGCAACTTTCTCTACAC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1150
Approximate temperature
55°C
  
PCR data   Exp. ID 12957
Forward primer (5'-3')
ATTGAAGCCACATATACTCATAGAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAGATTTTGCAACTTTCTCTACAC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 12958
Forward primer (5'-3')
ATTGAAGCCACATATACTCATAGAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAGATTTTGCAACTTTCTCTACAC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 680
Approximate temperature
55°C
  
PCR data   Exp. ID 12959
Forward primer (5'-3')
ATTGAAGCCACATATACTCATAGAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAGATTTTGCAACTTTCTCTACAC
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 1150+680
Approximate temperature
55°C
  
PCR data   Exp. ID 12960
Forward primer (5'-3')
ATTGAAGCCACATATACTCATAGAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAGATTTTGCAACTTTCTCTACAC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 12961
Forward primer (5'-3')
ATTGAAGCCACATATACTCATAGAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAGATTTTGCAACTTTCTCTACAC
Enzymes
  
Accessions and product sizes
Coffea canephora BP409: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 32911
Forward primer (5'-3')
ATTGAAGCCACATATACTCATAGAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAGATTTTGCAACTTTCTCTACAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 32912
Forward primer (5'-3')
ATTGAAGCCACATATACTCATAGAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAGATTTTGCAACTTTCTCTACAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 1100+680
Approximate temperature
55°C
  
PCR data   Exp. ID 32913
Forward primer (5'-3')
ATTGAAGCCACATATACTCATAGAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAGATTTTGCAACTTTCTCTACAC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1150
Approximate temperature
55°C
  
PCR data   Exp. ID 32914
Forward primer (5'-3')
ATTGAAGCCACATATACTCATAGAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAGATTTTGCAACTTTCTCTACAC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 10614
Forward primer (5'-3')
ATTGAAGCCACATATACTCATAGAAGC
Digested band sizes (using DraI)
Solanum pennellii LA716: 750+600
Solanum lycopersicum LA925: 1350
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAGATTTTGCAACTTTCTCTACAC
Enzymes
All possible enzymes for pennellii and and lycopersicum: DraI, HinfI, DpnII
All possible enzymes for lycopersicum and pimpinellifolium: DraI, HinfI, DpnII
  
Accessions and product sizes
Solanum pennellii LA716: 1350
Solanum lycopersicum LA925: 1350
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At2g20860  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7256 marker 7256
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)