SGN Marker C2_At2g24090

SGN-M7281
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle308290 (SGN)
128738 (CGN)
---
Capsicum annuumSingleSGN-U200041---
Lycopersicon CombinedSingleSGN-U218035---
Solanum tuberosumSingleSGN-U250489---
ArabidopsisSingleAt2g24090 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46631)
Chromosome
11
Position
8.80 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38319)
Chromosome
7
Position
0.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39579
Forward primer (5'-3')
AGGAGGAGAGCTGGGAAGCAG
Accessions and product sizes
Solanum pennellii TA56
2500
Solanum lycopersicum TA209
2700
Approximate temperature
55°C
Reverse primer (5'-3')
AATGCACCGATTACATTGTTG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
2700
Solanum pennellii TA56
2500
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25696)
Chromosome
2
Position
10.25 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10641
Forward primer (5'-3')
AGGAGGAGAGCTGGGAAGCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATGCACCGATTACATTGTTG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 2500
Approximate temperature
55°C
  
PCR data   Exp. ID 10642
Forward primer (5'-3')
AGGAGGAGAGCTGGGAAGCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATGCACCGATTACATTGTTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 2700
Approximate temperature
55°C
  
PCR data   Exp. ID 10643
Forward primer (5'-3')
AGGAGGAGAGCTGGGAAGCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATGCACCGATTACATTGTTG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 2700
Approximate temperature
55°C
  
PCR data   Exp. ID 12973
Forward primer (5'-3')
AGGAGGAGAGCTGGGAAGCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATGCACCGATTACATTGTTG
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 1650
Approximate temperature
55°C
  
PCR data   Exp. ID 12974
Forward primer (5'-3')
AGGAGGAGAGCTGGGAAGCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATGCACCGATTACATTGTTG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 12975
Forward primer (5'-3')
AGGAGGAGAGCTGGGAAGCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATGCACCGATTACATTGTTG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 12976
Forward primer (5'-3')
AGGAGGAGAGCTGGGAAGCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATGCACCGATTACATTGTTG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 12977
Forward primer (5'-3')
AGGAGGAGAGCTGGGAAGCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATGCACCGATTACATTGTTG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 3000
Approximate temperature
55°C
  
PCR data   Exp. ID 12978
Forward primer (5'-3')
AGGAGGAGAGCTGGGAAGCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATGCACCGATTACATTGTTG
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 500+3000
Approximate temperature
55°C
  
PCR data   Exp. ID 12979
Forward primer (5'-3')
AGGAGGAGAGCTGGGAAGCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATGCACCGATTACATTGTTG
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 3000
Approximate temperature
55°C
  
PCR data   Exp. ID 12980
Forward primer (5'-3')
AGGAGGAGAGCTGGGAAGCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATGCACCGATTACATTGTTG
Enzymes
  
Accessions and product sizes
Coffea canephora BP409: 250+2300
Approximate temperature
55°C
  
PCR data   Exp. ID 32919
Forward primer (5'-3')
AGGAGGAGAGCTGGGAAGCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATGCACCGATTACATTGTTG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 32920
Forward primer (5'-3')
AGGAGGAGAGCTGGGAAGCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATGCACCGATTACATTGTTG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 32921
Forward primer (5'-3')
AGGAGGAGAGCTGGGAAGCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATGCACCGATTACATTGTTG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 32922
Forward primer (5'-3')
AGGAGGAGAGCTGGGAAGCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATGCACCGATTACATTGTTG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 3000
Approximate temperature
55°C
  
PCR data   Exp. ID 10644
Forward primer (5'-3')
AGGAGGAGAGCTGGGAAGCAG
Digested band sizes (using amplicon difference)
Solanum lycopersicum LA925: 2700
Solanum pennellii LA716: 2500
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATGCACCGATTACATTGTTG
Enzymes
All possible enzymes for pennellii and and lycopersicum: amplicon difference
  
Accessions and product sizes
Solanum lycopersicum LA925: 2700
Solanum pennellii LA716: 2500
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Genomic location of C2_At2g24090  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7281 marker 7281
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)