SGN Marker C2_At2g24390

SGN-M7283
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeMultiple301208 (SGN)
121084 (CGN)
---
Capsicum annuumSingleSGN-U203843---
Solanum tuberosumSingleSGN-U245996---
ArabidopsisSingleAt2g24390 on TAIR---
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41375)
Chromosome
8
Position
2.10 cM
Confidence
I
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43351
Forward primer (5'-3')
AGATTTACATGGGGAATGGGACTTTG
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
ACTGAATTCCATTGTCATTGTCAAGAAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38322)
Chromosome
8
Position
3.50 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39582
Forward primer (5'-3')
AGATTTACATGGGGAATGGGACTTTG
Accessions and product sizes
Solanum lycopersicum TA209
350
Solanum pennellii TA56
350
Approximate temperature
55°C
Reverse primer (5'-3')
ACTGAATTCCATTGTCATTGTCAAGAAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25699)
Chromosome
2
Position
10.38 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10649
Forward primer (5'-3')
AGATTTACATGGGGAATGGGACTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACTGAATTCCATTGTCATTGTCAAGAAG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1750
Approximate temperature
55°C
  
PCR data   Exp. ID 10650
Forward primer (5'-3')
AGATTTACATGGGGAATGGGACTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACTGAATTCCATTGTCATTGTCAAGAAG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 2100
Approximate temperature
55°C
  
PCR data   Exp. ID 10651
Forward primer (5'-3')
AGATTTACATGGGGAATGGGACTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACTGAATTCCATTGTCATTGTCAAGAAG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 2100
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Genomic location of C2_At2g24390  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7283 marker 7283
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)