SGN Marker C2_At2g24940

SGN-M7291
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle300660 (SGN)
125168 (CGN)
---
Lycopersicon CombinedSingleSGN-U216910---
ArabidopsisSingleAt2g24940 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38325)
Chromosome
8
Position
20.30 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39584
Forward primer (5'-3')
AGCTAACCGCGGATGAGCTGAAG
Accessions and product sizes
Solanum pennellii TA56
200
Solanum lycopersicum TA209
200
Approximate temperature
55°C
Reverse primer (5'-3')
TTGAGAACAGCCATTTCTTTCTCAG
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
200
Solanum lycopersicum TA209
170
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25707)
Chromosome
2
Position
10.62 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10656
Forward primer (5'-3')
AGCTAACCGCGGATGAGCTGAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGAGAACAGCCATTTCTTTCTCAG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 230
Approximate temperature
55°C
  
PCR data   Exp. ID 10657
Forward primer (5'-3')
AGCTAACCGCGGATGAGCTGAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGAGAACAGCCATTTCTTTCTCAG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 230
Approximate temperature
55°C
  
PCR data   Exp. ID 10658
Forward primer (5'-3')
AGCTAACCGCGGATGAGCTGAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGAGAACAGCCATTTCTTTCTCAG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 230
Approximate temperature
55°C
  
PCR data   Exp. ID 32242
Forward primer (5'-3')
AGCTAACCGCGGATGAGCTGAAG
Digested band sizes (using XmnI)
Solanum pennellii LA716: 90+140
Solanum lycopersicum LA925: 230
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGAGAACAGCCATTTCTTTCTCAG
Enzymes
All possible enzymes for pennellii and and lycopersicum: XmnI
  
Accessions and product sizes
Solanum lycopersicum LA925: 230
Solanum pennellii LA716: 230
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At2g24940F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, PDF chromatogram
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, PDF chromatogram
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, PDF chromatogram
Forward amplicon sequence for S. pennellii TA56, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text

Genomic location of C2_At2g24940  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7291 marker 7291
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)