SGN Marker CT194

SGN-M73

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1200
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT194 image not available
Forward sequence
TTTTTTTTTTTCCTCCTCCAACTCCTCCCATTTCATATCCCTACACTTCTTCTTTTTACCCATCTACTATGAGCTCTGAGGTTTGTTCCA
CTTCCACAGAGATGAATTCCCAAATCTTTTCAACTGGGTTTTCTGGGTATGGAATGGAGCAACAGGGTTCAATTGGGCTGAATCAGTTAA
CCCCAATTCAGATCCAGCAAATTCAAGCTCAAATCAACTTTCAAAACCAACAACAACAGCAGCAGCAGCAGATGATGTTACAGACTGCCC
ATCATGCTTCCACCATGAATTTCTTGGCTCCAAAGCCGGTTCCAATGAAGCAATCTGGGTCGCCACCAAAACCCACGAAGCTCTACAGAG
GTGTTAGACAACGCCACTGGGGTAAGTGGGTCGCTGAGATCCGTTTGCCTAAGAACCGAACCCGCCTTTGGCTTGGTACATTTGACACCG
C
Reverse sequence
CTTTTTTTTTTTTTTTTTAGCTTAACCAATTTGGATTTTTATAAACCTAAAATATGAAGAAGAAAAAAACTACAAAGGAACTTGCCCTGC
AATTGCCAAAAACTCCATTGCAGTGACTCAATGTTCCATGGACCTAGTGACCTAGAACCACCATTAACAATTATAAACAATGCAAAAATA
CAAAAAAAAAAAAATACATAAGACCTCATTAAACCTAGACTTAATTTGATAATTACTACTAATTTTTTTCTTAATTATTTTCTAATTTTA
TAGAGAGGCCCAATCAATTTCATGAGATGGATACTTCTGCAACAAAAAATTTTCTGACATGTCCCAAGTTGGCTCTTCCTCAGTGAACTC
CGGGAATATCAGTTCGGTCACCGGCGATGATCCACCGGAACCGGAATGGGACCCGTCACTTTCGGATCCA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1564833.2e-0524 (5.3% of RFLP seq)+
SGN-U1564833.2e-0524 (5.3% of RFLP seq)+
SGN-U1480802e-0626 (5.8% of RFLP seq)+
SGN-U143801440 (97.6% of RFLP seq)+
SGN-U1438011.2e-75163 (37.9% of RFLP seq)-
SGN-U1438013e-119236 (54.9% of RFLP seq)-
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 51872)
Chromosome
4
Position
48.71 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Maturity_4 MQTL_1_Late_blight_5.2 MQTL_2_Late_blight_4
Potato meta-QTL consensus map

Map: Sun1642 x LA1589   
Map version
85 (location: 43642)
Chromosome
4
Position
85.50 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43042)
Chromosome
4
Position
74.80 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40745)
Chromosome
4
Position
79.00 cM
Confidence
uncalculated
Protocol
SSR


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39004)
Chromosome
4
Position
81.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Potato-TXB 1992   
Map version
27 (location: 7965)
Chromosome
4
Position
29.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 7964)
Chromosome
4
Position
61.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
CT194 was used as an overgo probe on plate 8 [well D2]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TCTGGGTATGGAATGGAGCAACAG
B sequence
TCAGCCCAATTGAACCCTGTTGCT
AB sequence
TCTGGGTATGGAATGGAGCAACAGGGTTCA
Marker sequence
TTTTTTTTTTTCCTCCTCCAACTCCTCCCATTTCATATCCCTACACTTCT
TCTTTTTACCCATCTACTATGAGCTCTGAGGTTTGTTCCACTTCCACAGA
GATGAATTCCCAAATCTTTTCAACTGGGTTTTCTGGGTATGGAATGGAGC
AACAGGGTTCAATTGGGCTGAATCAGTTAACCCCAATTCAGATCCAGCAA
ATTCAAGCTCAAATCAACTTTCAAAACCAACAACAACAGCAGCAGCAGCA
GATGATGTTACAGACTGCCCATCATGCTTCCACCATGAATTTCTTGGCTC
CAAAGCCGGTTCCAATGAAGCAATCTGGGTCGCCACCAAAACCCACGAAG
CTCTACAGAGGTGTTAGACAACGCCACTGGGGTAAGTGGGTCGCTGAGAT
CCGTTTGCCTAAGAACCGAACCCGCCTTTGGCTTGGTACATTTGACACCG
C
Genomic location of CT194  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D73 marker 73
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)