SGN Marker SSR57

SGN-M730

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 50 High: 50
Repeat motif: AAC   Repeat number: 6
Repeat motif:    Repeat number:
Forward primer: TCCATCTAAGGTCTTTGCCG
Reverse primer: ACAAAGGAAGTGGGAGAGCA
Predicted size: 125
Derivations 
This marker was derived from EST read SGN-E174802
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39263)
Chromosome
2
Position
4.50 cM
Confidence
I
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 31923
Forward primer (5'-3')
TCCATCTAAGGTCTTTGCCG
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
ACAAAGGAAGTGGGAGAGCA
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 125
Approximate temperature
50°C
  
Overgo hybridization and physical mapping 
SSR57 was used as an overgo probe on plate 11 [well E7]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CCCTTCTCATTGATGCTTCCGATG
B sequence
AAAGGAAGTGGGAGAGCATCGGAA
AB sequence
CCCTTCTCATTGATGCTTCCGATGCTCTCC
Marker sequence
TGGACGTTCGCCGGAGATCTGAAGAGCCTGTTTATCCATCTAAGGTCTTT
GCCGCCGATGAAAAACCTCTCAAACCCCACAAGAAACAACAACAACAACA
ACAAGAGGACAAAAATACCCTTCTCATTGATGCTTCCGATGCTCTCCCAC
TTCCTTTGTATCTCACTAATGGCTTGTTTTTCACTATGTTTTTCTCTGTT
ATGTATTTTCTTCTATCAAGGTGGCGTGAGAAAATCAGGAATTCCACTCC
TTTACATGTCGTTACGCTTTCTGAATTGGGTGCTATTGTTTCGTTAATTG
CTTCTGTCATTTATCTTCTCGGTTTCTTTGGGATTGGGTTTGTTCAGACA
TTTGTGTCAAGGGGAAATAATGATTCATGGGATGAAAATGATGAGGAATT
TCTATTGAAGGAAGATAGTCGTTGTGGACCTGCAACTACTCTTGGTTGTG
CACCACCTGCTCGACAAATTTCCCCAATGGCGCCACCTCAACCTTCTATG
TCTATGGTAGAGAAACCTGCACCTTT
Genomic location of SSR57  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D730 marker 730
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)