SGN Marker C2_At2g26270

SGN-M7307
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle304821 (SGN)
125288 (CGN)
---
Solanum tuberosumSingleSGN-U257487---
ArabidopsisSingleAt2g26270 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 25724)
Chromosome
2
Position
11.19 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41239
Forward primer (5'-3')
ATACTGTTTCCAGTTGATCGATTTTC
Accessions and product sizes
Solanum lycopersicum TA209
2000
Solanum pennellii TA56
2000
Approximate temperature
55°C
Reverse primer (5'-3')
ATTCGTTTGAATTCTACACAACCACGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  
Other PCR data 
PCR data   Exp. ID 10672
Forward primer (5'-3')
ATACTGTTTCCAGTTGATCGATTTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTCGTTTGAATTCTACACAACCACGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 360
Approximate temperature
55°C
  
PCR data   Exp. ID 10673
Forward primer (5'-3')
ATACTGTTTCCAGTTGATCGATTTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTCGTTTGAATTCTACACAACCACGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 360
Approximate temperature
55°C
  
PCR data   Exp. ID 10674
Forward primer (5'-3')
ATACTGTTTCCAGTTGATCGATTTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTCGTTTGAATTCTACACAACCACGC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 360
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At2g26270F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, PDF chromatogram
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, PDF chromatogram
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, PDF chromatogram
Forward amplicon sequence for S. pennellii TA56, plain text

Genomic location of C2_At2g26270  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7307 marker 7307
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)