SGN Marker C2_At2g26830

SGN-M7316
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle311515 (SGN)
132023 (CGN)
---
Capsicum annuumSingleSGN-U204937---
Solanum tuberosumSingleSGN-U252704---
ArabidopsisSingleAt2g26830 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38333)
Chromosome
8
Position
30.10 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39590
Forward primer (5'-3')
TCAAATCTAGATGGTTCTCACTTCTCTG
Accessions and product sizes
Solanum lycopersicum TA209
1700
Solanum pennellii TA56
1700
Approximate temperature
60°C
Reverse primer (5'-3')
AAGTGCGTGCATCAATAAATGACTG
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
1750
Solanum lycopersicum TA209
1700
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25733)
Chromosome
2
Position
11.45 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10685
Forward primer (5'-3')
TCAAATCTAGATGGTTCTCACTTCTCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGTGCGTGCATCAATAAATGACTG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 10686
Forward primer (5'-3')
TCAAATCTAGATGGTTCTCACTTCTCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGTGCGTGCATCAATAAATGACTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 10687
Forward primer (5'-3')
TCAAATCTAGATGGTTCTCACTTCTCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGTGCGTGCATCAATAAATGACTG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 32243
Forward primer (5'-3')
TCAAATCTAGATGGTTCTCACTTCTCTG
Digested band sizes (using TaqI)
Solanum pennellii LA716: 1400
Solanum lycopersicum LA925: 1500
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGTGCGTGCATCAATAAATGACTG
Enzymes
All possible enzymes for pennellii and and lycopersicum: HaeIII,TaqI (072205)
All possible enzymes for lycopersicum and pimpinellifolium: HaeIII
  
Accessions and product sizes
Solanum pennellii LA716: 1500
Solanum lycopersicum LA925: 1500
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At2g26830F.cds.txt, plain text
Amplicon sequence alignment, FASTA
At2g26830R.cds.txt, plain text
Reverse amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Reverse amplicon sequence for S. lycopersicum TA209, PDF chromatogram
Reverse amplicon sequence for S. lycopersicum TA209, plain text
Reverse amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Reverse amplicon sequence for S. pennellii TA56, PDF chromatogram
Reverse amplicon sequence for S. pennellii TA56, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text

Genomic location of C2_At2g26830  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7316 marker 7316
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)