SGN Marker C2_At2g27090

SGN-M7318
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle310185 (SGN)
129859 (CGN)
---
Lycopersicon CombinedSingleSGN-U224701---
ArabidopsisSingleAt2g27090 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49228)
Chromosome
9
Position
0.75 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47159)
Chromosome
9
Position
2.00 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38334)
Chromosome
9
Position
0.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39591
Forward primer (5'-3')
TCCGAAGTGATTATGATGCTAAGCG
Accessions and product sizes
Solanum lycopersicum TA209
500
Solanum pennellii TA56
500
Approximate temperature
55°C
Reverse primer (5'-3')
AGACAGAACAGGTGGTATAAATAGGTGG
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
200+300
Solanum lycopersicum TA209
500
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25735)
Chromosome
2
Position
11.58 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10691
Forward primer (5'-3')
TCCGAAGTGATTATGATGCTAAGCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGACAGAACAGGTGGTATAAATAGGTGG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 10692
Forward primer (5'-3')
TCCGAAGTGATTATGATGCTAAGCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGACAGAACAGGTGGTATAAATAGGTGG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 10693
Forward primer (5'-3')
TCCGAAGTGATTATGATGCTAAGCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGACAGAACAGGTGGTATAAATAGGTGG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 32244
Forward primer (5'-3')
TCCGAAGTGATTATGATGCTAAGCG
Digested band sizes (using BstNI)
Solanum lycopersicum LA925: 200+500
Solanum pennellii LA716: 180+200+300
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGACAGAACAGGTGGTATAAATAGGTGG
Enzymes
All possible enzymes for pennellii and and lycopersicum: BstNI,ScrFI
  
Accessions and product sizes
Solanum pennellii LA716: 700
Solanum lycopersicum LA925: 700
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At2g27090F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, PDF chromatogram
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, PDF chromatogram
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, PDF chromatogram
Forward amplicon sequence for S. pennellii TA56, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text

Genomic location of C2_At2g27090  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7318 marker 7318
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)