SGN Marker C2_At2g27490

SGN-M7325
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle311818 (SGN)
128093 (CGN)
---
Lycopersicon CombinedSingleSGN-U223914---
Solanum tuberosumMultipleSGN-U245979---
ArabidopsisSingleAt2g27490 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 25742)
Chromosome
2
Position
11.76 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41244
Forward primer (5'-3')
TGAAGAAAGGAACAGGTGGTTGG
Accessions and product sizes
Solanum lycopersicum TA209
2500
Solanum pennellii TA56
2500
Approximate temperature
55°C
Reverse primer (5'-3')
TTTAGTCCACTTGTCCATCTTGGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  
Other PCR data 
PCR data   Exp. ID 10702
Forward primer (5'-3')
TGAAGAAAGGAACAGGTGGTTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTAGTCCACTTGTCCATCTTGGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 2500
Approximate temperature
55°C
  
PCR data   Exp. ID 10703
Forward primer (5'-3')
TGAAGAAAGGAACAGGTGGTTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTAGTCCACTTGTCCATCTTGGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 2500
Approximate temperature
55°C
  
PCR data   Exp. ID 10704
Forward primer (5'-3')
TGAAGAAAGGAACAGGTGGTTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTAGTCCACTTGTCCATCTTGGC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 2500
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At2g27490  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7325 marker 7325
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)