SGN Marker C2_At2g27730

SGN-M7327
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle308481 (SGN)
130884 (CGN)
---
Capsicum annuumSingleSGN-U196637---
Lycopersicon CombinedSingleSGN-U219346---
Solanum tuberosumSingleSGN-U248649---
ArabidopsisSingleAt2g27730 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38337)
Chromosome
11
Position
69.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39594
Forward primer (5'-3')
TGGAGAAAGAGAAGCTGGAGAAGC
Accessions and product sizes
Solanum pennellii TA56
750
Solanum lycopersicum TA209
750
Approximate temperature
55°C
Reverse primer (5'-3')
TCCTTTGACATTAGGTACCAACCC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
400
Solanum pennellii TA56
450
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25744)
Chromosome
2
Position
11.83 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10705
Forward primer (5'-3')
TGGAGAAAGAGAAGCTGGAGAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTTGACATTAGGTACCAACCC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 880
Approximate temperature
55°C
  
PCR data   Exp. ID 10706
Forward primer (5'-3')
TGGAGAAAGAGAAGCTGGAGAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTTGACATTAGGTACCAACCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 880
Approximate temperature
55°C
  
PCR data   Exp. ID 10707
Forward primer (5'-3')
TGGAGAAAGAGAAGCTGGAGAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTTGACATTAGGTACCAACCC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 880
Approximate temperature
55°C
  
PCR data   Exp. ID 13007
Forward primer (5'-3')
TGGAGAAAGAGAAGCTGGAGAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTTGACATTAGGTACCAACCC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 300+900
Approximate temperature
55°C
  
PCR data   Exp. ID 13008
Forward primer (5'-3')
TGGAGAAAGAGAAGCTGGAGAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTTGACATTAGGTACCAACCC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 13009
Forward primer (5'-3')
TGGAGAAAGAGAAGCTGGAGAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTTGACATTAGGTACCAACCC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 13010
Forward primer (5'-3')
TGGAGAAAGAGAAGCTGGAGAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTTGACATTAGGTACCAACCC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 13011
Forward primer (5'-3')
TGGAGAAAGAGAAGCTGGAGAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTTGACATTAGGTACCAACCC
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 13012
Forward primer (5'-3')
TGGAGAAAGAGAAGCTGGAGAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTTGACATTAGGTACCAACCC
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 13013
Forward primer (5'-3')
TGGAGAAAGAGAAGCTGGAGAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTTGACATTAGGTACCAACCC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 32620
Forward primer (5'-3')
TGGAGAAAGAGAAGCTGGAGAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTTGACATTAGGTACCAACCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 32933
Forward primer (5'-3')
TGGAGAAAGAGAAGCTGGAGAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTTGACATTAGGTACCAACCC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 32934
Forward primer (5'-3')
TGGAGAAAGAGAAGCTGGAGAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTTGACATTAGGTACCAACCC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 32935
Forward primer (5'-3')
TGGAGAAAGAGAAGCTGGAGAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTTGACATTAGGTACCAACCC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 32936
Forward primer (5'-3')
TGGAGAAAGAGAAGCTGGAGAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTTGACATTAGGTACCAACCC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 32937
Forward primer (5'-3')
TGGAGAAAGAGAAGCTGGAGAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTTGACATTAGGTACCAACCC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 10708
Forward primer (5'-3')
TGGAGAAAGAGAAGCTGGAGAAGC
Digested band sizes (using HaeIII)
Solanum lycopersicum LA925: 650
Solanum pennellii LA716: 500
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTTGACATTAGGTACCAACCC
Enzymes
All possible enzymes for pennellii and and lycopersicum: HaeIII, DpnII
  
Accessions and product sizes
Solanum lycopersicum LA925: 880
Solanum pennellii LA716: 880
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At2g27730  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7327 marker 7327
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)