SGN Marker C2_At2g28600

SGN-M7341
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Lycopersicon CombinedSingleSGN-U220182---
Solanum tuberosumSingleSGN-U246514---
ArabidopsisSingleAt2g28600 on TAIR---
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41379)
Chromosome
12
Position
36.40 cM
Confidence
I
Protocol
dCAPS


Pepper-COSII

PCR data   Exp. ID 43355
Forward primer (5'-3')
AGCGATGATTCCATTCAGAGAAGG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TTCACGACAATTATTTTCTTTATTGA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38341)
Chromosome
11
Position
10.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39598
Forward primer (5'-3')
AGCGATGATTCCATTCAGAGAAGG
Accessions and product sizes
Solanum pennellii TA56
550
Solanum lycopersicum TA209
550
Approximate temperature
55°C
Reverse primer (5'-3')
TCCCCATGTATGGATGAAGAAAGGC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
500
Solanum lycopersicum TA209
520
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25758)
Chromosome
2
Position
12.26 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10715
Forward primer (5'-3')
AGCGATGATTCCATTCAGAGAAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCCCATGTATGGATGAAGAAAGGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 10716
Forward primer (5'-3')
AGCGATGATTCCATTCAGAGAAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCCCATGTATGGATGAAGAAAGGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 10717
Forward primer (5'-3')
AGCGATGATTCCATTCAGAGAAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCCCATGTATGGATGAAGAAAGGC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 10718
Forward primer (5'-3')
AGCGATGATTCCATTCAGAGAAGG
Digested band sizes (using DraI)
Solanum lycopersicum LA925: 1200
Solanum pennellii LA716: 500+700
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCCCATGTATGGATGAAGAAAGGC
Enzymes
All possible enzymes for pennellii and and lycopersicum: AflII,BglII,BstYI,DraI,EcoRI,HincII,HindIII,HinfI,RsaI
  
Accessions and product sizes
Solanum pennellii LA716: 1200
Solanum lycopersicum LA925: 1200
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At2g28600F.cds.txt, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, plain text

Genomic location of C2_At2g28600  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7341 marker 7341
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)