SGN Marker C2_At2g28800

SGN-M7343
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U200590---
Lycopersicon CombinedMultipleSGN-U225547---
Solanum tuberosumSingleSGN-U249532---
ArabidopsisSingleAt2g28800 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49230)
Chromosome
11
Position
48.88 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47161)
Chromosome
11
Position
74.40 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46635)
Chromosome
11
Position
78.70 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tobacco N. acuminata   
Map version
89 (location: 46466)
Chromosome
11
Position
61.80 cM
Confidence
F(LOD3)
Protocol
dCAPS


Tobacco N. acuminata

Map: Pepper-COSII   
Map version
58 (location: 41380)
Chromosome
11
Position
67.40 cM
Confidence
I(LOD2)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43356
Forward primer (5'-3')
TGAAGGATGGACTGCAAGCTGTGC
Accessions and product sizes
Approximate temperature
60°C
Reverse primer (5'-3')
TGCAAGAGGATTGACCCCTGCCTG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38343)
Chromosome
11
Position
58.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

Map: Arabidopsis COSII   
Map version
44 (location: 25760)
Chromosome
2
Position
12.36 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At2g28800  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7343 marker 7343
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)