SGN Marker C2_At2g29630

SGN-M7349
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeMultiple300408 (SGN)
120454 (CGN)
---
Capsicum annuumSingleSGN-U198281---
Solanum tuberosumSingleSGN-U263164---
ArabidopsisSingleAt2g29630 on TAIR---
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41382)
Chromosome
6
Position
47.60 cM
Confidence
I
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43358
Forward primer (5'-3')
TCTGAGACCTGGTTCAATTTATGATGC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TGGTACGTGTCCAGGCCCTTCATTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38346)
Chromosome
6
Position
4.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 41251
Forward primer (5'-3')
TCTGAGACCTGGTTCAATTTATGATGC
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
TGGTACGTGTCCAGGCCCTTCATTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25766)
Chromosome
2
Position
12.68 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At2g29630  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7349 marker 7349
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)