SGN Marker C2_At2g30200

SGN-M7352
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U205419---
Lycopersicon CombinedSingleSGN-U216455---
Solanum tuberosumMultipleSGN-U244684---
ArabidopsisSingleAt2g30200 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38348)
Chromosome
1
Position
16.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39602
Forward primer (5'-3')
TGCTCATCTTCAACTTTGATTCTTCC
Accessions and product sizes
Solanum pennellii TA56
1450
Solanum lycopersicum TA209
1450
Approximate temperature
55°C
Reverse primer (5'-3')
TGGCTTAGAACAGTGGAGTCTAACTTC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
300+400+750
Solanum lycopersicum TA209
400+1050
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25769)
Chromosome
2
Position
12.89 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10726
Forward primer (5'-3')
TGCTCATCTTCAACTTTGATTCTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGCTTAGAACAGTGGAGTCTAACTTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1650
Approximate temperature
55°C
  
PCR data   Exp. ID 10727
Forward primer (5'-3')
TGCTCATCTTCAACTTTGATTCTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGCTTAGAACAGTGGAGTCTAACTTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1650
Approximate temperature
55°C
  
PCR data   Exp. ID 10728
Forward primer (5'-3')
TGCTCATCTTCAACTTTGATTCTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGCTTAGAACAGTGGAGTCTAACTTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1650
Approximate temperature
55°C
  
PCR data   Exp. ID 32253
Forward primer (5'-3')
TGCTCATCTTCAACTTTGATTCTTCC
Digested band sizes (using HaeIII)
Solanum lycopersicum LA925: 1650
Solanum pennellii LA716: 1500
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGCTTAGAACAGTGGAGTCTAACTTC
Enzymes
All possible enzymes for pennellii and and lycopersicum: AseI,BsiHKAI,BsoBI,BspDI,BstUI,BstXI,DraI,EcoRI,HaeIII,NheI,SsPI,XhoI
All possible enzymes for lycopersicum and pimpinellifolium: BstUI,NheI
  
Accessions and product sizes
Solanum pennellii LA716: 1650
Solanum lycopersicum LA925: 1650
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At2g30200F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text

Genomic location of C2_At2g30200  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7352 marker 7352
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)