Sol Genomics Network

SGN Marker C2_At2g30200

SGN-M7352
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

Synonyms

None

Locus associations

None

Orthologs in this COSII group

Species	Copies	Sequence ID	CDS/Edited sequence	Peptide sequence	Predicted introns
Capsicum annuum	Single	SGN-U205419	-	-	-
Lycopersicon Combined	Single	SGN-U216455	-	-	-
Solanum tuberosum	Multiple	SGN-U244684	-	-	-
Arabidopsis	Single	At2g30200 on TAIR	-	-	-

Mapped locations

Map: Tomato-EXPEN 2000
Map version 52 (location: 38348)
Chromosome 1
Position 16.50 cM
Confidence I
Protocol CAPS

Tomato-EXPEN 2000

PCR data Exp. ID 39602

Forward primer (5'-3')

TGCTCATCTTCAACTTTGATTCTTCC

Accessions and product sizes

Solanum pennellii TA56

1450

Solanum lycopersicum TA209

1450

Approximate temperature

55°C

Reverse primer (5'-3')

TGGCTTAGAACAGTGGAGTCTAACTTC

Digested band sizes (using amplicon difference)

Solanum pennellii TA56

300+400+750

Solanum lycopersicum TA209

400+1050

Mg⁺² concentration

1.5mM

Enzymes

Map: Arabidopsis COSII
Map version 44 (location: 25769)
Chromosome 2
Position 12.89 MB
Confidence uncalculated
Protocol CAPS

Arabidopsis COSII

Other PCR data

PCR data Exp. ID 10726
Forward primer (5'-3') TGCTCATCTTCAACTTTGATTCTTCC		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TGGCTTAGAACAGTGGAGTCTAACTTC	Enzymes
Accessions and product sizes Solanum pennellii LA716: 1650	Approximate temperature 55°C

PCR data Exp. ID 10727
Forward primer (5'-3') TGCTCATCTTCAACTTTGATTCTTCC		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TGGCTTAGAACAGTGGAGTCTAACTTC	Enzymes
Accessions and product sizes Solanum lycopersicum LA925: 1650	Approximate temperature 55°C

PCR data Exp. ID 10728
Forward primer (5'-3') TGCTCATCTTCAACTTTGATTCTTCC		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TGGCTTAGAACAGTGGAGTCTAACTTC	Enzymes
Accessions and product sizes Solanum pimpinellifolium LA1589: 1650	Approximate temperature 55°C

PCR data Exp. ID 32253
Forward primer (5'-3') TGCTCATCTTCAACTTTGATTCTTCC	Digested band sizes (using HaeIII) Solanum lycopersicum LA925: 1650 Solanum pennellii LA716: 1500	Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TGGCTTAGAACAGTGGAGTCTAACTTC	Enzymes All possible enzymes for pennellii and and lycopersicum: AseI,BsiHKAI,BsoBI,BspDI,BstUI,BstXI,DraI,EcoRI,HaeIII,NheI,SsPI,XhoI All possible enzymes for lycopersicum and pimpinellifolium: BstUI,NheI
Accessions and product sizes Solanum lycopersicum LA925: 1650 Solanum pennellii LA716: 1650	Approximate temperature 55°C

Universal primers for Asterid species

No additional PCR data found.

Other COSII sequence data

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Related Markers

Related Genotyped Markers: These markers have been genotyped and share a name with this marker

Genomic location of C2_At2g30200

%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7352 marker 7352

User comments

Please wait, checking for comments. (If comments do not show up, access them here)

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL:

SGN is supported by , and hosted at
Cite SGN using | Disclaimer