SGN Marker C2_At2g30410

SGN-M7355
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeMultiple299742 (SGN)
124950 (CGN)
---
Capsicum annuumSingleSGN-U197008---
Lycopersicon CombinedSingleSGN-U221876---
Solanum tuberosumSingleSGN-U265321---
ArabidopsisSingleAt2g30410 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 25772)
Chromosome
2
Position
12.97 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41253
Forward primer (5'-3')
AGGAGCTCCATTCCTATGAGAAAGAG
Accessions and product sizes
Solanum pennellii TA56
380
Solanum lycopersicum TA209
380
Approximate temperature
53°C
Reverse primer (5'-3')
TCTGCTATTATGTTTCGAGCTTCTTC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
270
Solanum pennellii TA56
380
Mg+2 concentration
1.5mM
   Enzymes
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At2g30410  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7355 marker 7355
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)