SGN Marker C2_At2g32760

SGN-M7377
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle308644 (SGN)
128112 (CGN)
---
Capsicum annuumSingleSGN-U201378---
Lycopersicon CombinedMultipleSGN-U218817---
Solanum tuberosumSingleSGN-U261673---
ArabidopsisSingleAt2g32760 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38352)
Chromosome
9
Position
102.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39605
Forward primer (5'-3')
TACATCTGCTCTTAATGAAGCTAAGC
Accessions and product sizes
Solanum lycopersicum TA209
900
Solanum pennellii TA56
900
Approximate temperature
63°C
Reverse primer (5'-3')
TCTCTTTGACAACTTTAGAATGCATTG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
500
Solanum pennellii TA56
500
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25794)
Chromosome
2
Position
13.90 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 32255
Forward primer (5'-3')
TACATCTGCTCTTAATGAAGCTAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTCTTTGACAACTTTAGAATGCATTG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 32256
Forward primer (5'-3')
TACATCTGCTCTTAATGAAGCTAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTCTTTGACAACTTTAGAATGCATTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 32257
Forward primer (5'-3')
TACATCTGCTCTTAATGAAGCTAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTCTTTGACAACTTTAGAATGCATTG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 32258
Forward primer (5'-3')
TACATCTGCTCTTAATGAAGCTAAGC
Digested band sizes (using TaqI)
Solanum pennellii LA716: 800
Solanum lycopersicum LA925: 270+530
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTCTTTGACAACTTTAGAATGCATTG
Enzymes
All possible enzymes for pennellii and and lycopersicum: AflII,BsaBI,BstBI,EcoRI,Hpy188I,TaqI
  
Accessions and product sizes
Solanum pennellii LA716: 800
Solanum lycopersicum LA925: 800
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At2g32760  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7377 marker 7377
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)