SGN Marker SSR65

SGN-M738

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 42.857 High: 50
Repeat motif: AG   Repeat number: 5
Repeat motif: TG   Repeat number: 7
Repeat motif:    Repeat number:
Forward primer: GGCAGGAGATTGGTTGCTTA
Reverse primer: TTCCTCCTGTTTCATGCATTC
Predicted size: 230
Mapped locations  
Map: Sun1642 x LA1589   
Map version
85 (location: 43817)
Chromosome
1
Position
132.80 cM
Confidence
uncalculated
Protocol
SSR


Sun1642 x LA1589

PCR data   Exp. ID 44835
Forward primer (5'-3')
GGCAGGAGATTGGTTGCTTA
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TTCCTCCTGTTTCATGCATTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43277)
Chromosome
1
Position
135.00 cM
Confidence
uncalculated
Protocol
SSR


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

PCR data   Exp. ID 44649
Forward primer (5'-3')
GGCAGGAGATTGGTTGCTTA
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TTCCTCCTGTTTCATGCATTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-LXCHM 2007   
Map version
68 (location: 43003)
Chromosome
1
Position
61.20 cM
Confidence
uncalculated
Protocol
SSR


Tomato-LXCHM 2007

PCR data   Exp. ID 44003
Forward primer (5'-3')
GGCAGGAGATTGGTTGCTTA
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TTCCTCCTGTTTCATGCATTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40770)
Chromosome
1
Position
148.00 cM
Confidence
uncalculated
Protocol
SSR


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39288)
Chromosome
1
Position
159.00 cM
Confidence
I
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 18
Forward primer (5'-3')
GGCAGGAGATTGGTTGCTTA
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCCTCCTGTTTCATGCATTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 233+233
Solanum pennellii LA716: 219+233
Approximate temperature
50°C
  
Overgo hybridization and physical mapping 
SSR65 was used as an overgo probe on plate 8 [well B10]

Plausible BAC Matches:   P329N17,   P245J01,   P324B14,   P233G14,   P156P05,   P014I13,   P287L07

 Overgo Sequences

A sequence
CTGATGTTTTGGACCCAGCTCTTC
B sequence
AATCGACCAGGACGAAGAAGAGCT
AB sequence
CTGATGTTTTGGACCCAGCTCTTCTTCGTC
Marker sequence
GCACGAGGTTGGATGGATTTGACCAGCTTGGAAAGGTTTATATTGATCTT
AAATGTATATTTCCATGAAAATGTGTTGTGATTGTCCATGATCTAAGATG
TGCATCCTTTCGAGTTTCTCTTTGAACTCTCTTAGTTTGATTTTCCCTGC
CGTGTCAAAAAGATTTCTTCAAGTTGGTTTTTTTTTATTTAAGGCAGGAG
ATTGGTTGCTTATCAACATACTGTTGGAATCTGCACATAAAACGATACAC
CATTTAAATGACCCTATGCTTATGTTTTCTTTCTTGGTTTTTTCTTTTGG
GTGCTTGTTTTTTTTTTTTGTGTGTGTGTGTGAGAGAGAGAGACCTTAGG
GCTTAGATTCTTTTTGATTTATAACATTTGAAATTTCCTAAAGAAAGAGT
AGAATGCATGAAACAGGAGGAAGATATTGTCTGTTCACCTGAACCTATTT
AATCATTATTCTATCTTCAGGTAAAAATGATTATGGCAACAAATAGACCT
GATGTTTTGGACCCAGCTCTTCTTCGTCCTGGTCGATTAGATAGAAAGAT
AGAAATCCCCTTGCCTAATGAACAATCAAGAATGGAAATCCTCAAGATCC
ATGCTGCTGGGATTGCCAAACATGGTGAAATTGATTATGAGGCTGCTG
Genomic location of SSR65  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D738 marker 738
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)