SGN Marker C2_At2g32970

SGN-M7381
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle312062 (SGN)
127803 (CGN)
---
Lycopersicon CombinedSingleSGN-U223302---
Solanum tuberosumSingleSGN-U253046---
ArabidopsisSingleAt2g32970 on TAIR---
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41384)
Chromosome
7
Position
53.90 cM
Confidence
I
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43360
Forward primer (5'-3')
TCTGTGGGAAAGTACGTATGCTCC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TCTGTTGCAGGCTGTGAAAAATGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38354)
Chromosome
7
Position
40.70 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39607
Forward primer (5'-3')
TCTGTGGGAAAGTACGTATGCTCC
Accessions and product sizes
Solanum pennellii TA56
1300
Solanum lycopersicum TA209
1300
Approximate temperature
55°C
Reverse primer (5'-3')
TCTGTTGCAGGCTGTGAAAAATGC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
800
Solanum lycopersicum TA209
750
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25798)
Chromosome
2
Position
14.00 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10760
Forward primer (5'-3')
TCTGTGGGAAAGTACGTATGCTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGTTGCAGGCTGTGAAAAATGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 10761
Forward primer (5'-3')
TCTGTGGGAAAGTACGTATGCTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGTTGCAGGCTGTGAAAAATGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 10762
Forward primer (5'-3')
TCTGTGGGAAAGTACGTATGCTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGTTGCAGGCTGTGAAAAATGC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 10763
Forward primer (5'-3')
TCTGTGGGAAAGTACGTATGCTCC
Digested band sizes (using AluI)
Solanum lycopersicum LA925: 220
Solanum pennellii LA716: 320
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGTTGCAGGCTGTGAAAAATGC
Enzymes
All possible enzymes for pennellii and and lycopersicum: AluI
All possible enzymes for lycopersicum and pimpinellifolium: NlaIII/FatI/CviAII/Hin1II/Hsp92II
  
Accessions and product sizes
Solanum pennellii LA716: 350
Solanum lycopersicum LA925: 350
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At2g32970F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, PDF chromatogram
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, PDF chromatogram
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, PDF chromatogram
Forward amplicon sequence for S. pennellii TA56, plain text
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At2g32970  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7381 marker 7381
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)